A gene-specific T2A-GAL4 library for Drosophila

1Knowing where a gene is expressed and where the encoded protein is localized within the cell provides critical insight into the function of almost any gene. The use of antibodies and molecular manipulation of genes have provided key tools to assess gene expression and protein localization in Drosophila. For example, thousands of P-element mediated enhancer detectors have been used to assess expression patterns. The original enhancer trap vectors were based on the presence of a relatively weak, neutral promoter driving lacZ that can be acted upon by adjacent enhancers as P elements often insert in 5’ regulatory elements. In adapting a powerful binary expression system first developed in yeast for use in Drosophila, replaced lacZ with GAL4 to induce expression of UAS-effectors (e.g. GFP, cDNAs, shRNAs). They showed that this technology allowed labeling of cells to assess gene expression patterns and drive expression of cDNAs. This binary system has been used to perform tissue-specific knockdown using UAS-RNAi constructs, carry out intersectional approaches to refine expression patterns in select neuronal populations via Split-GAL4 technology, perform stochastic neuronal labeling approaches via MARCM (Mosaic Analysis with a Repressible Cell Marker), block synaptic transmission or induce neuronal excitation to assess neuronal activity, as well as numerous other manipulations.

2We previously developed the MiMIC (Minos-Mediated Insertion Cassette) technology to permit integration of any DNA cassette at a site where the MiMIC transposable element is inserted. We created fly stocks with nearly 17,500 MiMIC insertions and characterized their properties. MiMICs contain two ϕC31 attP sites that can be used to exchange the integrated cassette with diverse cassettes containing two attB sites through Recombinase Mediated Cassette Exchange (RMCE). We used RMCE to generate a library of protein trap lines where we inserted a cassette consisting of SA (Splice Acceptor)-GFP-SD (Splice Donor) (short for SA-GSS-EGFP-FIAsH-StrepII-TEV-3XFlag-GSS-SD, also abbreviated GFSTF, GFP-tag) into 400 MiMICs inserted in coding introns (introns flanked by two coding exons). The synthetic GFP exon is spliced into the mRNA of the gene, leading to the translation of a protein with an internal GFP tag. This intronic GFP tagging approach allows us to determine which cells express the corresponding gene/protein and assess subcellular protein distribution. Importantly, ~75% of intronically tagged genes appear functional. These endogenous GFP-tagged lines provide an excellent tool to survey subcellular distribution of the encoded proteins. In addition, the GFP tagged proteins can be knocked down in a spatially and temporally restricted fashion, and loss of the GFP-tagged protein is reversible using the deGradFP technique as long as the gene is actively transcribed, allowing elegant in vivo manipulation.

3More recently, developed a T2A-GAL4 technology, named Trojan GAL4, that integrates a cassette consisting of a SA-T2A-GAL4-polyA (polyadenylation signal) in coding introns of genes that carry MiMICs to assess the expression pattern of genes and measure or block neuronal activity. The polyA should arrest transcription of the gene in which the MiMIC is inserted, generating a truncated transcript. T2A is a viral ribosomal skipping site that arrests translation, which becomes reinitiated after the site, producing untagged GAL4 protein. The ability to replace intronic MiMICs with T2A-GAL4 opens many avenues that are complementary to tagging genes that carry intronic MiMICs with SA-GFP-SD (the GFSTF tag). Indeed, T2A-GAL4 could allow determination of expression patterns, notably including in tissues or cells where genes are expressed at such low levels that they cannot easily be detected using the GFSTF tag approach. Although, driving UAS-GFP with GAL4 amplifies expression levels and greatly increases sensitivity, subcellular localization information is lost. In addition, SA-T2A-GAL4-polyA should cause a severe loss-of-function mutation (i.e. a truncated transcript due to the polyA signal) unless the SA allows exon skipping or the truncated protein is functional. Moreover, integration of a transgene carrying a UAS-cDNA for the gene that is mutated (GOI, gene of interest) should rescue phenotypes induced by insertion of a SA-T2A-GAL4-polyA cassette, allowing quick and efficient structure-function analyses. Finally, numerous other manipulations based on GAL4/UAS technology can be explored to assess function including those of species homologues, to query neuronal connectivity, impair activity, ablate cells, or assess gene or cellular functions, as well as various other applications. So far, about 50 genes have been reported to be tagged with a Trojan-GAL4 cassette. Hence, the power and generality of this technology remains to be explored. The potential usefulness of a large collection of T2A-GAL4 insertion fly stocks led us to create a large library; assess the features, properties, and robustness of the T2A-GAL4 method; and explore some of the potential applications of the technology.

4Here, we report the conversion of 619 intronic MiMICs with T2A-GAL4. Given that there are only ~1860 genes containing MiMICs inserted between coding exons that can be used for tagging with T2A-GAL4, we tested a number of vectors for CRISPR-mediated integration and eventually developed a vector and an efficient, gene-specific protocol for T2A-GAL4 insertion that we named CRIMIC (CRISPR-Mediated Integration Cassette). Using this approach, we tagged 388 genes using CRIMIC. We characterized genetic features associated with these T2A-GAL4 insertions, document numerous novel expression patterns, and provide compelling evidence that this library of ~1000 strains will permit a wide variety of elegant and highly valuable genetic, cell biological, and neurobiological applications.

5As a part of the Gene Disruption Project, we created and sequenced the flanks of ~15,660 MiMIC insertions. Of these 2854 are intronic insertions that permit tagging of 1862 different genes. We classified 1399 insertions as ‘Gold’ as they are predicted to tag all transcripts annotated in FlyBase, 550 are ‘Silver’ and tag more than 50% of all gene transcripts, whereas 193 are ‘Bronze’ and tag less than 50% of the transcripts. As some genes are tagged with multiple MiMICs, the total is greater than 1862. We prioritized the tagging of 881 genes that have one or more human homolog (DIOPT Score ≥4) and are part of the ‘Gold’ collection. In addition, 139 ‘Gold’ MiMICs in genes with low-confidence orthologs (DIOPT Score ≤3) or not conserved in humans were also selected, along with a number of ‘Silver’ and ‘Bronze’ insertions (see Flypush: http://flypush.imgen.bcm.tmc.edu/MIMIC/lines.php). We successfully tagged 611 genes with GFSTF, and 211 in this work. We previously showed that conversion of MiMICs with GFSTF allows for efficient tagging of genes that carry intronic MiMICs and that 90% of intronically GFP-tagged proteins show robust GFP signals in third instar larval brains. However, staining of adult brains revealed robust expression in only ~19% of the GFP-tagged genes tested (114/611, Figure 1—figure supplement 1). To achieve higher adult brain expression we prioritized genes based on the presence of human homologs and converted 619 MiMIC insertions to SA-T2A-GAL4-polyA (see Flypush: http://flypush.imgen.bcm.tmc.edu/pscreen/rmce).

6We generated both GFP (GFSTF) and T2A-GAL4 tagged lines by converting the same original MiMIC line through RMCE and compared the expression patterns for 104 genes, to assess if expression was consistently increased. Figure 1A shows expression in third instar larvae and adult brains of four proteins tagged with GFP. The expression and localization of the proteins encoded by nAChRalpha1, dpr15, Pxn and Gprk2 are easily detectable in third instar larval brains and ventral nerve cords, yet exhibit weak or no detectable signals in adult brains. In contrast, the gene expression pattern visualized using T2A-GAL4 converted MiMICs and assayed with UAS-mCD8::GFP (Figure 1B and C) exhibits robust GFP signals in third instar and adult brains. This method of integrating the T2A-GAL4 is very efficient and is less time consuming than integrating GFSTF, as RMCE-mediated conversion events can be easily detected by scoring insertion events crossed to UAS-2xEGFP and screening for expression in any tissue in embryos, larvae, or adults.

7We previously showed that genes tagged with GFSTF faithfully reproduce the expression and subcellular distribution pattern of all tagged proteins tested. We confirmed this observation as the similarities between GFSTF localization (Figure 1—figure supplement 1) and published antibody staining for Cactus, Rgk1, Discs large 1, and Bruchpilot in the brain are obvious. However, GAL4 strongly amplifies the expression of UAS-mCD8::GFP when compared to the endogenous GFP tagged proteins but the subcellular protein distribution is lost. As shown in Figure 1—figure supplement 2, in non-neuronal tissue the expression patterns as gauged with mCD8::GFP driven by T2A-GAL4 or antibody staining overlap significantly for arm in larval wing disc, Mhc in larval muscle, and osa in larval eye-antenna imaginal discs (Figure 1—figure supplement 2A) when assessed at low resolution. However, for trio, which encodes a Rho guanyl-nucleotide exchange factor that regulates filamentous actin, the expression patterns do not overlap extensively, even at low resolution. Trio is known to play a role in the mushroom body (MB) neurons as well as in motor neurons at neuromuscular junctions (NMJs). However, the localization of the Trio protein (Figure 1—figure supplement 2A red, bottom row) in the larval central brain and ventral nerve cord (VNC) appears different from the GAL4 >UAS-mCD8::GFP pattern since GFP is strongly expressed throughout the MB and VNC, whereas the expression of Trio protein is low in VNC and the protein is localized to NMJs (red staining, insert). Similarly, we observe that mCD8::GFP driven by T2A-GAL4 is also present at the NMJs (green staining, inset). In summary, the data are consistent and suggest that Trio is expressed in many neurons, including the motor neurons.

8A comparison of the expression patterns of four genes tagged with both GFSTF and T2A-GAL4>mCD8::GFP exemplifies differences in the expression patterns. As shown in Figure 1—figure supplement 2B, the patterns of SIFaR, zip, VGlut and mbl are difficult to reconcile without further characterization. In summary, both the T2A-GAL4 and the GFSTF conversions provide valuable information and should permit different applications.

9In order to vastly expand the collection of MiMIC-tagged genes, we initially tried to use CRISPR technology to insert MiMIC-like constructs and developed two vectors, pM14 and pM36. pM14 contains a MiMIC-like cassette (attP-FRT-SA-3XSTOP-polyA-3xP3-EGFP-FRT-attP) whereas pM36 lacks the FRT sites present in pM14 (Figure 2A). Homology arms approximately 500–1000 bp in length were added to each side of these cassettes by Golden Gate Assembly (GGA) to generate donor plasmids for homology directed repair (Figure 2B).

10To ensure similar and clean genetic backgrounds for all transformation experiments, we isogenized the second and third chromosomes of the nos-Cas9 flies into which we injected our constructs. We used the FindCRISPR tool which is based on a pre-computed database of CRISPR sgRNA designs requiring the presence of a PAM sequence at the end and a unique seed region. All sgRNA designs used the reference genome from FlyBase. Homology arms were amplified from genomic DNA from the isogenized nos-Cas9 injection lines.

11The mix of sgRNAs and donor vectors was injected into embryos expressing Cas9, under the nanos promoter (nos-Cas9), to ensure germline expression for integration into introns of the GOI in a directional manner. We injected constructs for 89 genes with pM14 with a success rate of 57%, and 114 genes with pM36 with a success rate of only 26% (Figure 2—figure supplement 1A). The insertion efficiencies of these constructs were deemed too low, and thus they are no longer used in our production pipeline.

12The utility of the T2A-GAL4 lines generated by RMCE of MiMICs encouraged us to use CRISPR/Cas9 to insert SA-T2A-GAL4-polyA in introns of GOI using the CRISPR/Cas9 system, similar to the T-GEM vector developed by. However, we added flanking FRT sites to allow excisions of the cassette with Flippase. We therefore designed a set of vectors with a swappable MiMIC-like cassette that contains attP-FRT-SA-T2A-GAL4 (with phases 0, 1, and 2)-polyA- 3xP3-EGFP-FRT-attP named pM37 (Figure 3A).

13Upon many trials we settled on injecting 25 ng/µl of a single sgRNA and 150 ng/µl of the -SA-T2A-GAL4-polyA- donor construct (pM37) with ~1 kb homology arms on either side in isogenized nos-Cas9 flies. As summarized in Figure 4A, we injected approximately 500 embryos for each of 557 different genes. The fly crosses for each target chromosome are documented in Supplementary file 1. The percentage of injected embryos surviving to first instar was 23% and on average 4.6 flies expressing GFP in the eye (3xP3-GFP) were recovered per injection. Molecular analysis of lines started from each individual GFP+ fly revealed that at least one insertion in the GOI was obtained for nearly 70% of the genes (Figure 4A). All insertions were confirmed by PCR (see Materials and Methods or Flypush for protocols and corresponding primers; Figure 2—figure supplement 1B). Note that the efficiency is higher if we omit the data for genes that map to the third chromosome as the nos-Cas9 transgene insertion on the second chromosome carries a recessive lethal mutation, reducing the efficiency significantly. Alternative nos-Cas9 insertions on the second and X chromosomes are being tested to improve the efficiency.

14To assess expression patterns of the GOIs, we crossed the transgenic flies to UAS-mCD8::RFP, which labels cell membranes and thus can be easily distinguished from the 3XP3-GFP tag, which is used as a selectable marker for transgenesis and is sparsely expressed in the nervous system (Figure 3B). As shown in Figure 3C, the insertions in different genes produce a variety of expression patterns. For ten genes picked at random, several different independently isolated and sequenced insertions for a given gene exhibited very similar expression patterns, suggesting that the method is robust.

15The design of pM37 and the ability to use CRISPR should provide the following advantages: first, the ability to insert the CRIMIC cassettes in sites that affect all transcripts encoded by a gene and create severe loss-of-function or null alleles (Figure 4—figure supplement 1A); second, the ability to excise the mutagenic cassette in vivo (revert) using UAS-FLP under the control of GAL4 inserted in the GOI to assess if the CRIMIC cassette is indeed responsible for the observed phenotypes (Figure 4—figure supplement 1B); third, the ability to revert loss-of-function phenotypes in any tissues at any time to assess when a protein is required and if loss of the gene causes a permanent or reversible phenotype at the time of excision; fourth, the ability to choose an integration site that does not disrupt protein domains upon retagging with GFSTF (Figure 4—figure supplement 1C); fifth, the ability to insert any DNA flanked by attB sites and replace the SA-T2A-GAL4-polyA cassette. These include the following available cassettes: GFSTF, mCherry, GAL80, LexA, QF, and split-GAL4. Finally, the ability to test for rescue of the mutant phenotypes by driving the corresponding UAS-cDNA, a feature that also allows for structure-function analysis (Figure 4—figure supplement 1D).

16Insertion of a SA-T2A-GAL4-polyA in a coding intron should arrest transcription at the polyA signal (PAS or AATAAA) unless the site is masked. Hence, MiMIC and CRIMIC T2A-GAL4 insertions should cause a severe loss-of-function mutation in most but not all cases, depending on where the SA-T2A-GAL4-polyA is inserted and whether or not all transcripts are effectively disrupted by the cassette (Figure 4—figure supplement 1A). To test the mutagenic capacity of the T2A-GAL4 cassette, we selected insertions in 100 genes (82 MiMIC-derived insertions and 18 CRIMICs, Supplementary file 2) that are annotated in FlyBase (http://flybase.org/) as essential genes, based on previous publications. Of these, 80 were categorized as ‘Gold’, 14 as ‘Silver’ and six as ‘Bronze’ (Supplementary file 2). We performed complementation tests using 99 molecularly defined deficiencies (Dfs) that remove the affected gene and one P-element insertion for Cka (Supplementary file 2). As shown in Figures 4B, 90 insertions fail to complement the lethality, five are semi-lethal (less than 5% escapers), and five are viable (see Discussion).

17Because the SA-T2A-GAL4-polyA cassette should prematurely terminate transcription, and as the cassette in CRIMICs is flanked by FRT sequences, we next tested if the lethality associated with eleven insertions can be reverted by using the GAL4 to drive UAS-FLP (Figure 4—figure supplement 1B). We tested excision of 11 CRIMIC T2A-GAL4 insertions in essential genes on the X chromosome by simply crossing them with UAS-FLP. As shown in Figure 4C, eight out of eleven hemizygous lethal insertions on the X chromosome produced numerous viable flies when crossed to UAS-FLP. To assess the efficiency of FLP/FRT mediated CRIMIC cassette excision for the three genes for which we did not observe viable flies (Dsor1, Raf and Marf), we tested if the T2A-GAL4/+;+/+;UAS-FLP/+ females lacked the 3xP3-GFP marker associated with the T2A-GAL4 insertions. As shown in Figure 4—figure supplement 2, these flies did not express or barely expressed GFP in the eye, indicating that the efficiency of FLP-mediated excision is high. Given the rescue failure, we also tested whether these lines carry second-site recessive lethal mutations. However, all three are rescued by a genomic P[acman] clone (Table 1) indicating that these chromosomes do not carry second-site lethal mutations. All together, we conclude that cassette excision can revert the phenotype in most cases, providing a simple and powerful tool to assess the requirement for a gene product in a variety of cells and assess if the phenotype of interest is caused by the loss-of-function of the GOI (see Discussion).

18Expression of GAL4 may allow rescue of the lethality associated with an insertion by driving expression of a UAS-cDNA in a pattern that corresponds to the gene (Figure 4—figure supplement 1D). However, this may not be effective in many cases as the vast majority of genes have more than one splice isoform, and rescue with any one isoform encoded by a UAS-cDNA construct might not work (Table 1). In addition, many cDNAs are tagged at the C-terminal end and it has been estimated that about 22% of the genes tagged with 3XHA and 33% tagged with GFP disrupt gene function. Moreover, since the GAL4/UAS system is an over-expression system, cDNA rescue may not be possible for genes that are sensitive to dosage. Nevertheless, we assessed the ability of a single UAS-cDNA per gene to rescue mutant phenotypes associated with disruption of 36 genes for which we were able to find a UAS-cDNA. For 11 genes on the X-chromosome, we assessed rescue of male lethality, whereas for genes on the second and third chromosomes, we assessed rescue of SA-T2A-GAL4-polyA-induced lethality over the corresponding Dfs that fail to complement the lethality. To ensure that the lethality of the genes on the X-chromosome is indeed associated with the insertions, we first performed genomic rescue using the 80 kb P[acman] BAC transgenic lines. The lethality of all genes on the X-chromosome was rescued with the corresponding P[acman] clones (Table 1), indicating that these chromosomes are very unlikely to carry second-site mutations. Of the 36 essential genes that carry SA-T2A-GAL4-polyA, 25 (~70%) could be rescued by a single UAS-cDNA driven by the endogenous GAL4 (Figure 4D; Table 1).

19The sensitivity of T2A-GAL4 tagging allows us to determine where genes are expressed, especially when expression levels in specific cell populations are low, as shown for the adult brain in Figure 1. We therefore determined the expression patterns of 550 genes in adult brains and documented expression patterns of many genes that have not been previously reported (Figure 5; Figure 5—figure supplements 1–3). Nearly 80% of all tested tagged genes are expressed in adult brains.

20The smallest category of genes (9/550 or 2%) corresponds to genes expressed in trachea, a tubular system that provides oxygen to all tissues. For example, breathless (btl) encodes a protein kinase expressed specifically in the trachea and is involved in tracheal branching. A comparison of the GAL4>UAS-mCD8::GFP expression pattern of a GAL4 based P-element enhancer detector in btl (P[GawB]btlNP6593) and the T2A-GAL4 insertion (MI03286-TG4.0) in the brain and thoracicoabdominal ganglion (TAG) show very similar mesh-like tracheal patterns. Another gene previously documented to be expressed in trachea, empty spiracles (emp), also shows that the T2A-GAL4 insertion drives expression in trachea. In Figure 5 and Figure 5—figure supplement 1, we report the expression of seven other genes that have not been reported to be expressed in trachea (FlyBase 2.0/FB2017_06). Hence, nine genes out of 550 tested are expressed in trachea and for seven of these, detection of expression in the trachea is novel (Frl, CG8213, sprt, geko, ex, Samuel, Cad96Ca).

21The next most frequent category consists of genes whose expression are mostly confined to a subtype of cells corresponding to glia. Glia account for about 10% of the cells in the fly brain and about 50% of cells in the mammalian brain. To assess various glial patterns in the brain upon UAS-mCD8::GFP expression, we selected five known glial cell GAL4 drivers as controls: repo-GAL4 (all glia except midline glia), gcm-GAL4 (embryonic glia), NP2222-GAL4 (cortex glia), NP6520-GAL4 (ensheathing glia) and NP1243-GAL4 (astrocyte-like glia). We identified 19/550 genes that are mostly or specifically expressed in one or several types of glia cells. Seven were previously shown to be expressed in glia: CIC-a, loco, CG10702, CG6126, Gs2, Egfr and Tret1-1 (Figure 5; Figure 5—figure supplement 2), whereas 12 have not previously been associated with glial expression based on available data (bdl, Zasp52, rols, ine, CG5404, CG14688, CG31663, ry, CG4752, βTub97EF, CG32473, LManII; Figure 5 and Figure 5—figure supplement 2). Note that ry (rosy) is known to be expressed in pigment cells of the eye, and that these cells function as glial cells in this organ.

22Finally, about 80% of lines showed expression patterns in adult brain neurons. Given the complexity of the brain and the sheer number of different expression patterns in neurons, we decided to focus on a single neuronal population that is easily identifiable and on expression patterns that were not previously documented. We selected the neurons of the pars intercerebralis (PI), which are located on the dorsal medial side of the brain and project to the tritocerebrum and the corpora cardiaca in the middle central area. They secrete a variety of neuropeptides as well as Drosophila Insulin Like Peptides or DILPs. This cluster of neurons is a neuroendocrine command center that not only controls cell growth by releasing DILPs but also controls fly behaviors, including aggression, via secreted neuropeptides. The gene IIp2 encodes Insulin-like peptide 2. An Ilp2 promotor GAL4 fusion (P{Ilp2-Gal4}) was used to express mCD8::GFP in a subset of PI neurons as a positive control. The expression of GFP in PI neurons driven by T2A-GAL4 insertions in AstA-R2 (Allatostatin A receptor 2) and Lkr (Leucokinin receptor), agrees well with previous observations of their expression in these neurons, In addition, we found 18 genes (CG31547, if, NimB2, Lerp, CG7744, cnc, CG2656, spin, gem, Fs, Aldh-III, CG33056, grsm, CG31075, Pi3K68D, Dh44-R2, Lgr4, Atg16) that are expressed in PI neurons and yet have not been previously described as such (FlyBase 2.0/FB2017_06) (Figure 5; Figure 5—figure supplement 3).

23Here, we report the creation of ~1000 T2A-GAL4 lines by two different methods: 619 generated by RMCE of MiMIC insertions and 388 by CRIMIC, a novel CRISPR-mediated strategy. Our success rate of MiMIC T2A-GAL4 conversion was 68.1% (543/797) upon a single attempt and 41.1% (76/185) upon a second attempt. Hence, we failed twice for 109 out of 797 genes. The T2A-GAL4 insertions not only provide a GAL4 driver that reveals the cells in which the targeted genes are expressed with great sensitivity but also allow many useful applications for testing gene function. We show that the CRIMIC technology is as powerful and reproducible as converting MiMICs with T2A-GAL4, and we should therefore be able to tag at least half of the genes in the Drosophila genome with the T2A-GAL4 CRIMIC approach as they carry suitable introns that are large enough.

24While the conversion of MiMICs depends on the presence of intronic MiMIC insertions, the CRIMIC approach allows us to select many genes that do not carry a MiMIC but contain an intron that is large enough and has proper sgRNA target sites to introduce a cassette that carries SA-T2A-GAL4-polyA flanked by FRT sites. The cloning success rate for the donor vector was about 80% on a first attempt, but significantly higher when repeated for another intron. This should allow us to tag about ~45–50% of all fly genes as those with short coding introns or without introns cannot be targeted using this strategy. By injecting ~535 embryos/construct we average a 70% successful integration rate. If we exclude the data for the third chromosome, where the nos-Cas9 isogenized strain used was sub-optimal, our success rate is ~80%. We do not anticipate that we will be able to improve this much in the future except for the third chromosome. However, we are currently developing strategies with much shorter homology arms to avoid cloning and reduce the number of injected embryos, as our approach is labor-and cost-intensive. Indeed, we estimate that each line requires approximately ~50 hr of work for technicians, postdoctoral fellows, and bioinformaticians to obtain a single characterized stock deposited in the BDSC.

25This technology is based on the properties of the SA-T2A-GAL4-polyA cassette. Issues with efficiency of those properties may limit the use of this cassette. First, skipping of the SA would reduce or abolish the gene-trap function of this cassette, leading to hypomorphic or neutral alleles of the GOI. The SA used here corresponds to intron 18 of Mhc, a SA that has been used before. We show that this SA is quite effective, as lethal insertions in essential genes fail to complement the lethality of known alleles and deficiencies in 90% of the cases tested. These data also indicate that a second feature of the cassette, the polyA signal, is efficient at arresting transcription. As previously shown for a few genes, GAL4 drives UAS-GFP or RFP expression efficiently in all cases tested and permits detection of expression in cells that express low mRNA and protein levels (Figure 1 and Figure 3). Although the GAL4/UAS binary system strongly enhances the detection sensitivity when compared to the expression of the endogenous gene in the adult head tagged with GFSTF, this is much less the case in the third instar larval CNS (Figure 1 and Figure 1—figure supplement 2B). We have no obvious explanation for this discrepancy. In summary, although it is impossible to prove that the GAL4 is faithfully mimicking the endogenous expression given its enhanced sensitivity, the data we have compiled so far indicate that these insertions accurately represent the expression of the vast majority of genes.

26The latter feature is important, as current GAL4-driver resources developed at the Janelia Research Campus and Vienna Drosophila Resource Center are based on very different premises. The driver transgenes were engineered to label few neurons. Indeed sparse labeling is a prerequisite to study neural networks. Given that the regulatory elements of genes used to create these collections are removed from their endogenous context it is difficult to determine which enhancers mimic a portion of the expression pattern of the gene they have been derived from, as repressors may not be present and enhancers may be truncated or not tested (FlyLight). Hence, it should now be possible to compare the patterns of the genes presented here with those based on GAL4 patterns driven by the ~2–3 kb fragments used in these studies.

27Given the caveats associated with CRISPR technology, it is important to demonstrate that an observed phenotype is indeed associated with the insertion. In addition, we have previously shown that the genetic manipulations based on MiMIC can induce a significant number of second-site mutations. We therefore attempted to rescue the lethal phenotypes associated with CRIMIC T2A-GAL4 insertions with UAS-FLP, as this should excise the cassette. We found that 8 of 11 CRIMIC insertions that cause lethality were reverted with UAS-FLP (Figure 4C), providing a quick tool to assess genetic background load. The results of this experiment also indicate that the cassette can be excised with other FLP drivers like LexA or hsp70 promoter driven FLP. Hence, most chromosomes engineered through CRISPR in this study do not carry second-site lethal mutations and this was confirmed with genomic P[acman] rescue constructs: all mutations tested were rescued with the corresponding P[acman] clones (Table 1). The data also indicate that the delay between FLP production by GAL4 and excision is not critical for most essential genes. Finally, we note that the failure to rescue lethality was not due to a failure of excision for Dsor1, Raf and Marf. Indeed, flies that express GAL4 and FLP lack GFP expression in the eyes (Dsor1) or produce very little GFP derived from the 3xP3-EGFP marker (Raf and Marf) (Figure 4—figure supplement 2), suggesting that excision of the T2A-GAL4 cassette was successful in all cases tested. Hence, tissue-specific excision should easily be induced using hs-FLP or another binary system, allowing one to perform conditional rescue experiments and assess in some cases when and where proteins are required. In summary, combining the features of T2A-GAL4 with the FLP-mediated excision system provides numerous possibilities.

28One of the most useful applications of T2A-GAL4 may be the ability to use SA-T2A-GAL4-polyA with UAS-cDNAs to perform structure-function analyses, that is, test the consequences of removal of protein domains and/or of introducing point mutations into the UAS-cDNA construct, or even to test the rescue ability of human cDNAs and variants. The odds that this strategy will be effective for the majority of genes seem limited at first glance given the following issues: the test is done with a single cDNA yet two or more protein isoforms are encoded by the vast majority of genes (Table 1); there may be issues with expression levels as shown for UAS-GFP versus GFSTF; timing of protein production may be delayed; and finally, tagging of cDNAs (HA or GFP) has been documented to impair function for ~20–30% of the tagged cDNAs. Nevertheless, as shown in Table 1, about 70% of the UAS-cDNA constructs were able to rescue lethality, despite the fact that nearly all genes tested encode more than one protein isoform. In addition, no obvious pattern emerged from these data with respect to the presence or absence of a tag (Chi sq. = 0.0004, p=0.98), and no pattern emerged with respect to rescue of lethal mutations, as these genes encode anywhere from 1 to 20 protein isoforms but often could be rescued with a single cDNA (Table 1). Establishing that there is complete rescue of all phenotypes, not just lethality, would be time consuming and require detailed studies including longevity, fertility, and numerous behavioral assays beyond the scope of this work. We note that we also previously showed that intronic tagging with GFSTF disrupted about 25% of the genes. Hence, we recommend that both tagged and untagged cDNAs be tested whenever possible.

29In summary, this library provides a set of ~1000 gene-specific GAL4 drivers for the fly community. We are in the process of creating numerous other T2A-GAL4 insertions as part of the Gene Disruption Project and we prioritize genes based on the nomination from scientific community through a web site (http://www.flyrnai.org/tools/crimic/web/). The GAL4/UAS system is a very well established binary approach and this T2A-GAL4 library will provide numerous additional tools to survey gene and circuit function in combination with many other existing genetic tools such as UAS-RNAi, UAS-fly cDNA, UAS-GCaMP, UAS-ChR, UAS-shits and so on. For an estimated 90% of the genes tested, the insertion of SA-T2A-GAL4-polyA causes a severe loss-of-function mutation and only three insertions displayed dominant phenotypes out of ~1000 genes tested. Finally, the T2A-GAL4 flies provide a very useful platform for functional testing of fly as well as human genes and their possible disease variant(s).

30Fly stocks were maintained on standard cornmeal-yeast-agar medium at 25°C, and on a 12/12 hr light/dark cycle. The MiMIC and CRIMIC flies were created in the Bellen lab (see Flypush or Supplementary file 2). UAS-2xEGFP, hs-Cre,vas-dϕC31, Trojan T2A-GAL4 triplet flies were from Dr. Ben White. The RMCE conversion of MiMICs with GFSTF and T2A-GAL4 cassettes was described in previous studies. The crossing schemes for CRIMICs are shown in Supplemental Information 1. btl-GAL4, Ilp2-GAL4, repo-GAL4, gcm-GAL4, UAS-mCD8::GFP, UAS-mCD8::RFP, P[acman] flies, and UAS-FLP flies were obtained from the Bloomington Drosophila Stock Center (BDSC, USA). UAS-if was from Dr. Celeste Berg. NP1243-GAL4, NP2222-GAL4, and NP6250-GAL4 are from Kyoto Stock Center (Kyoto DGGR, Japan). Dfs flies were from BDSC or Kyoto DGGR. UAS-cDNA flies were from BDSC or FlyORF (Switzerland). y,w;attP40(y+){nos-Cas9(v+)}/CyO and y,w;+/+; attP2(y+){nos-Cas9(v+)} were isogenized in this work. See Supplementary file 2 for the genotypes and stock numbers of fly stocks. All references to FlyBase are based on FlyBase 2.0/FB2017_06.

31TypeIISRE-attP-FRT-SA-3xStop-SV40-3xP3-GFP-SV40-FRT-attP-TypeIISRE fragment was synthesized in two parts by GENEWIZ (www.genewiz.com) in the pUC57 vector (pM5 and pM7 were synthesized by GENEWIZ). Next, the ~1.2 kb fragment of attP-FRT-SA-3xStop-SV40-3xP3 in pM5 was digested with BstXI and EagI. The ~1.3 kb fragment of GFP-SV40-FRT-attP in pM7 was digested with EagI and EcoRV. To generate pM14, these two DNA fragments were separated and purified from agarose gel and ligated with pBS-deltaBsaI vector which was digested with BstXI and EcoRV (molar ratio of insert:vector = 5:1). The ligation mix (1 μg/8 μl total DNA + 1 μl 10xT4 DNA Ligase Buffer + 1 μl T4 DNA ligase) was incubated at 16°C overnight then transformed into NEB® Stable E. coli competent cells. Cells were raised on ampicillin (50 μg/ml)/LB agar plate at 37°C overnight. pM14 plasmids were checked by double digestion of BstXI and EcoRV.

32pM36 was modified from pM14 by removing two FRT sites in pM14 by mutagenesis. pM36 was modified from pM14 by sequentially adding 25 nucleotides flanking each of the attP sites for sequencing the inserted homology arms and mutating the two FRT sites to render them nonfunctional. In brief, a NsiI-EcoRI fragment containing the necessary modifications was cloned by PCR from oligos (DLK256 = taaatATGCATcgatcgtctggtactacattcacgcGTACTGACGGA

33CACACCGAAGCccc (fwd) and DLK331 = AGAGAGAATTCCTACATGGTAATGT TACTAGAGAATAGGAACTTCTCGCGCTC (rev)) using pM14 as a template and inserted between the NsiI and EcoRI sites to replace the original pM14 sequence, followed by cloning a XbaI-SphI fragment from pM14 with the necessary modifications for the downstream site using the oligos (DLK332 = TATTCTCTAGAAACATTACCATGTAGTCGCGCTCGCGCGACTGACG (fwd) and DLK255 = GGTAGGAAGACAACGCGCAGTGAAGGACGAGAGGTAGTACC GCATGCGTACTGACGGACACACCG (rev)) and replacing the pM14 sequences between the XbaI and SphI sites.

34pM37 vectors were modified from pM14 by replacing 3xStop with T2A-GAL4 of different phases from pT-GEM vectors of the corresponding phase. Briefly the EcoRI-PstI fragment of pM14 was subcloned in pBluescript SK and mutagenized by PCR mutagenesis to replace 3XStop sequences with AscI restriction enzyme site and subcloned back in pM14 vector. T2A-GAL4 sequences were PCR amplified from pT-GEM vector and cloned in EcoRI/MfeI and AscI sites in mutated pM14, generating pM14 T2A-GAL4 vector. AscI-SbfI fragment of T2A-GAL4 was resynthesized to remove Type IIS RE sites by substituting base pairs corresponding to Type IIS REs with synonymous mutations eliminating the sites. The resulting fragment was subcloned in pM14 T2A-GAL4 vector. pM14 and pM36 vectors were found to be unstable in bacteria, frequently recombining out the 3XP3-GFP cassette. Further analysis showed that 3XP3 promoter fragment of pM14 and pM36 was 290 bps longer than other vectors that use the same marker. Shortening this fragment by PCR and replacing the AscI-FseI fragment with the shortened fragment improved stability of the vector in bacteria, creating the pM37 vector. Sequences of pM14, pM36 and pM37 can be found in Supplementary file 3.

35We analyzed the introns of all protein-coding genes of Drosophila melanogaster annotated at FlyBase and selected the genes that have at least one CDS intron that is >100 bp and is shared by all isoforms. Based on FlyBase release 6.16, there are 5822 protein-coding genes that meet these criteria. Then, we removed the genes that are covered by the MIMIC Gold collection and prioritized the genes if their human ortholog(s) are disease-related. We also prioritized genes based on the nomination from scientific community through a web site (http://www.flyrnai.org/tools/crimic/web/). sgRNA targeting the qualified CDS introns were selected based on their efficiency score and specificity annotated at Find CRISPR Tool. The homology arms upstream or downstream of the cutting site were designed using Primer3. We required that the homology arms are between 500 and 1200 bp in length, less than 40 bp apart from each other, and free of one or more of the three restriction enzymes (BsaI, BbsI, BsmBI) used for cloning.

36Donor constructs were generated as previously described. Briefly, homology arms were PCR amplified from genomic DNA using Q5 or Phusion polymerase (NEB), run on an agarose gel and purified with the QIAquick Gel Extraction Kit (Qiagen). The homology arms, pBH donor vector and pM14/pM36/pM37 cassette were combined by Golden Gate assembly using the appropriate type IIS restriction enzyme (BbsI, BsaI, or BsmBI). The resulting reaction products were transformed into Stbl3 or TOP10 Chemically Competent Cells (ThermoFisher), and plated overnight under kanamycin selection. Colonies were cultured for 24 hr at 30°C and DNA prepared by miniprep. The entire homology arm sequence and 300–500 bps of the adjacent cassette sequence were verified prior to injection.

37sgRNA constucts were generated as previously described. Briefly, sense and antisense oligos containing the 20 bp guide target sequence were annealed and phosphorylated with T4 Polynucleotide Kinase (NEB), then inserted between BbsI sites in the pl100 sgRNA expression vector. Ligation products were transformed into TOP10 Competent Cells (ThermoFisher), and plated overnight. Colonies were cultured, DNA prepared by miniprep, and sequences verified prior to injection. We injected a mix of 25 ng/μl sgRNA and 150 ng/μl donor DNA in isogenized fly embryos of the following genotypes y,w; attP40(y+){nos-Cas9(v+)}/CyO and y,w; +/+; attP2(y+){nos-Cas9(v+)} to generate CRIMIC insertions.

38For validation of MiMIC conversion and CRIMIC cassette insertion events, the genomic DNA was extracted from ~20 adult flies using the PureLink Genomic DNA Mini Kit (Invitrogen). For MiMIC conversions, four reactions of PCR were performed with tag-specific primers and MiMIC specific primers as described previously. The PCR reaction mix was: 1 μl genomic DNA (~10 ng), 1 μl primer 1 (10 μM), 1 μl primer 2 (10 μM), 4.5 μl H2O, and 7.5 μl GoTaq Green Master Mix (Promega). Hot start PCR conditions in C100 Touch Thermal Cycler (Bio-Rad) were: denaturation at 95° for 1 min, 34 cycles at 95° for 30 s, 56° for 30 s and 72° for 60 s, and post-amplification extension at 72° for 10 min. For CRIMIC cassette insertion, two reactions of PCR were performed with target-specific primers (see our website at Flypush) and attP-R primer (5’-CCCCAGTTGGGGC-3’) (Figure 2—figure supplement 1). PCR reaction mix was: 1 μl genomic DNA (~10 ng), 1 μl primer 1 (10 μM), 1 μl primer 2 (10 μM), 4.5 μl H2O, and 7.5 μl GoTaq Green Master Mix (Promega). Hot start PCR conditions in C100 Touch Thermal Cycler (Bio-Rad) were: denaturation at 95° for 1 min, 40 cycles at 95° for 30 s, 56° for 30 s and 72° for 2 min 30 s, and post-amplification extension at 72° for 10 min.

39Virgin female pM37 flies were collected and crossed with male flies carrying a UAS-FLP on the third chromosome. The adult eyes of pM37/+;+/+;UAS-FLP/+ for insertions in Dsor1, Raf and Marf were imaged with a fluorescent microscope (Zeiss SteREO Discovery.V20).

40Confocal imaging was performed as described previously. In brief, dissected adult brains or VNCs were fixed in 4% paraformaldehyde/1xPBS at 4°C overnight, transferred to 2% Triton X-100/1xPBS at room temperature, vacuumed for 1 hr and left overnight in the same solution at 4°C. The larvae brains or other tissues were fixed in 4% paraformaldehyde/1 xPBS at 4°C for at least 2 hr, transferred to 0.5% Triton X-100/1xPBS at 4°C for overnight. For immunostaining, the samples were blocked in 10% NGS/0.5% Triton X-100/1xPBS and incubated with primary antibodies (1:50 ~ 200 dilution) at 4°C for overnight with shaking, then washed with 0.5% Triton X-100/1xPBS for 5 min three times. The secondary antibodies conjugated with Alexa-488 or Alexa-647 (Jackson ImmunoResearch) were diluted 1:100 ~ 500 in 0.5% Triton X-100/1xPBS and incubated with samples at 4°C for overnight with shaking. For immunostaining of GFP, the samples were incubated with anti-GFP antibody conjugated with FITC (1:500) (Abcam) in 1xPBS with 0.5% Triton X-100 for overnight. Samples were cleared and mounted in RapiClear (SunJin Lab Co.) and imaged with a Zeiss LSM 880 Confocal Microscope under a 20x or 40x C-Apochromat water immersion objective lens.