Tip cell-specific requirement for an atypical Gpr124- and Reck-dependent Wnt/β-catenin pathway during brain angiogenesis

1Endothelial cells (ECs) acquire organ-specific characteristics to adapt to the requirements of their host tissues. The central nervous system (CNS) vascular microenvironment serves as a paradigm for blood vessel specialization because CNS ECs develop a set of junctional, cellular trafficking, and metabolic properties, collectively called the blood–brain barrier (BBB), that protect the CNS from blood-borne toxins and pathogens. Brain angiogenesis and barriergenesis are temporally coupled through a distinct, and tissue-specific, developmental program. The best characterized class of angiogenic and BBB-inductive signals operates through the Wnt/β-catenin pathway (canonical Wnt signaling), with distinct sets of ligands, receptors, and co-receptors controlling vascular development in different CNS locations. For example, in the embryonic forebrain and ventral spinal cord, neural progenitor-derived Wnt7a and Wnt7b activate Wnt/β-catenin signaling in ECs to control both angiogenesis and BBB formation. In the retina, the Muller glia-derived ligand Norrin, in conjunction with the receptor Frizzled4 (Fz4), co-receptor Lrp5, and co-activator Tspan12, mediate Wnt/β-catenin signaling to control angiogenesis and blood-retina barrier (BRB) formation and maintenance.

2In addition to classical components of the Wnt/β-catenin pathway, such as Frizzled receptors and Lrp5/Lrp6 co-receptors, recent evidence indicates that a unique signal transduction complex containing Gpr124, an orphan receptor of the adhesion GPCR family, operates specifically in CNS ECs to promote Wnt7a and Wnt7b angiogenic signaling. In mouse embryos, eliminating neuroepithelial Wnt7a and Wnt7b, or endothelial Gpr124 or β-catenin, leads to reduced CNS angiogenesis with production of abnormal vascular structures, termed glomeruloids, that fail to acquire BBB characteristics. Whether these vascular malformations are exclusively the result of defective endothelial Wnt/β-catenin signaling or are also influenced by signals from hypoxic tissues has not been determined.

3At present, the cellular mechanisms by which Wnt/β-catenin signaling controls the complex and multistep process of CNS blood vessel formation remain largely unexplored. Here, we leverage the zebrafish model to study the molecular machinery governing Wnt-dependent brain angiogenesis using a combination of targeted mutagenesis, morpholino knock-downs, RNA injections, genetic mosaics, and single-cell resolution real-time imaging. We find that EC-specific and Gpr124-dependent Wnt/β-catenin signaling is required for angiogenic sprouting throughout the zebrafish brain. In addition, we identify Reck (reversion-inducing-cysteine-rich protein with Kazal motifs), a GPI-anchored MMP inhibitor and angiogenic modulator, as a novel and essential activator of Wnt/β-catenin signaling during CNS angiogenesis, and we show that Gpr124 and Reck physically interact and strongly synergize in mammalian cells to promote Wnt/β-catenin signaling exclusively via Wnt7a and Wnt7b. Finally, by using live imaging of genetically mosaic animals, we have discovered a tip cell-autonomous requirement for Gpr124- and Reck-dependent Wnt/β-catenin signaling during sprouting angiogenesis in the CNS. These experiments demonstrate that Wnt/β-catenin signaling specifically regulates tip cell function and reveal that coordination of tip and stalk cell behaviors within nascent vessels and organ-specific specialization, generally viewed as distinct aspects of vascular development, can in fact be tightly coupled.

4To examine the function of Gpr124 during zebrafish development, we generated two gpr124 mutant alleles using TAL effector nucleases. The TALEN pairs were directed towards sequences within exons 7 and 16, corresponding to the Ig-like domain and second transmembrane helix, respectively (Figure 1A). We identified frame-shift mutant alleles, gpr124s984 and gpr124s985, which lead to premature stop codons after 10 and 39 amino acid-long missense segments following the lesion site (Figure 1—figure supplement 1). Heterozygous carriers of either mutant allele display no obvious anatomical or behavioral phenotype. Homozygous gpr124s984 and gpr124s985 mutants, although morphologically indistinguishable from wild-type siblings (Figure 1B), exhibit specific and highly penetrant brain vascular defects (Figure 1C, D). The initial assembly of the perineural vessels is unaffected in the absence of Gpr124. Between 28 and 32 hpf (hours post fertilization), the paired ventro-lateral primordial hindbrain channels (PHBC) and primordial midbrain channels (PMBC) that extend along the rostro–caudal axis, establish wild-type-like connections with the medial basilar artery (BA) and the more rostral V-shaped posterior communicating segments (PCS).

5From 32 hpf in wild-type embryos, the intracerebral central arteries (CtAs) begin to form by angiogenic sprouting from the dorsal wall of the PHBCs. These sprouts progress dorso-medially into the neural tissues to connect with the basilar artery and by 36 hpf, an average of four sprouts per hindbrain hemisphere have formed. In contrast, gpr124 mutants completely lack these forming vessels (Figure 1C). Defects in CNS vascularization are fully penetrant in gpr124 mutants and at 60 hpf the entire brain remains avascular, while intersegmental vessel (ISV) sprouting from the dorsal aorta appears to be unaffected (Figure 1C, D, E, Videos 1 and 2). Injection of an anti-sense morpholino targeting the splice donor site of gpr124 exon 6 dose-dependently mimicked the mutant vascular phenotype (Figure 1E) and both the mutant and morphant phenotypes could be partially rescued by the injection of RNA encoding the full-length receptor (Figure 1F). Asymmetric or unilateral rescues are sometimes observed (Figure 2G), possibly as a result of uneven distribution of the injected RNA within the yolk cell. Gpr125, a closely related adhesion GPCR, did not demonstrate angiogenic potential in a similar rescue assay. We mapped the functional differences between the receptors to components of the extracellular domain (Figure 1F).

6Remarkably, gpr124 mutant zebrafish can proceed through organogenesis in the complete absence of intracerebral blood vessels and approximately half of them reach adulthood (Figure 1—figure supplement 2), some becoming fertile. Adult gpr124 mutants exhibit a CNS vascular network that appears of equal density to that of wild-type animals (Figure 1G, upper panels), indicating that CNS vascularization can ultimately occur in the absence of Gpr124. This late-onset brain vascularization program starts after 5 dpf (days post fertilization) with a varying degree of expressivity (Figure 1—figure supplement 2). The adult gpr124-deficient CNS vessels can acquire all tested BBB characteristics as revealed by immunostaining for Slc2a1 (Glut1), Pgp and by permeability assays (Figure 1G).

7Non-transgenic homozygous gpr124 mutants are first distinguishable from wild-type siblings by their reduced growth rate and eventually by the disrupted pigmentation patterns of their skin after metamorphosis (after 14 dpf). In contrast to the regular pattern of alternating longitudinal melanophore-rich dark stripes and light interstripes found in wild-types, gpr124 mutants exhibit discontinuous stripes formed by clusters of melanophores bordered by xanthophores and iridophores, most prominently in the dorsal aspect of the trunk (Figure 2A). Metamorphic melanophores derive from a postembryonic stem cell population residing in close association with the segmentally arranged dorsal root ganglia (DRG), and adult pigmentation defects have been previously correlated with abnormal DRG formation. Accordingly, gpr124 mutants fail to form DRGs with both sox10:mRFP+ satellite glial cells and ngn1:EGFP+ neurons missing in most segments at 72 hpf (Figure 2B, C). On rare occasions, ganglia could be identified in the anterior-most segments of the trunk. The DRG defects do not result from the initial failure to specify the neuroglial lineage, as sox10:mRFP+ cells formed transient aggregates in all segments of gpr124 mutants at earlier stages. The ganglia however never contained ngn1:EGFP+ neurons as seen in wild-type siblings and were not retained at later stages (Figure 2D). Other neural crest derivatives, like the embryonic pigment cells and lateral line glia, appear to develop normally, ruling out a general requirement for Gpr124 in neural crest-derived tissues.

8In order to identify the components of the molecular pathway through which Gpr124 operates, we tested whether previously described regulators of DRG formation could, like Gpr124, additionally control CNS angiogenesis. Using a morpholino knock-down approach, we identified Reck, a GPI-anchored MMP inhibitor and angiogenic modulator as a novel essential regulator of brain vascularization (Figure 2E). Reck and Gpr124 knockdown embryos exhibit identical CNS-specific vascular defects without detectable ISV or gross morphological phenotypes (Figure 2F, I). Other DRG regulators like Sorbs3 and Erbb3b do not appear to modulate CNS angiogenesis specifically (Figure 2E). Reck knock-down dose-dependently blocked brain vascularization (Figure 2F), and at doses of morpholino above 1 ng, brains remained avascular. As previously reported, reck morphants completely lack DRGs at 72 hpf despite normal initial specification of sox10:mRFP+ neuroglial cells, much like gpr124 mutants (Figures 2D and 3C).

9The remarkable phenotypic similarities observed after gpr124 and reck knock-downs in two settings of distinct embryological origin led us to probe their functional relationship. In both the CNS vascular and peripheral neurogenic settings, ectopic expression of Gpr124 or Reck could compensate for their respective loss-of-function but no functional epistatic relationship could be detected, that is, the absence of one protein could not be rescued by overexpression of the other (Figure 2G, H). This result is compatible with one of the following two scenarios: Gpr124 and Reck act in independent parallel pathways, or they act in concert to control a common signaling pathway during both CNS angiogenesis and DRG neurogenesis.

10Wnt/β-catenin signaling controls CNS vascular formation in mouse and instructs sensory neural cell fates during DRG development. We tested whether Gpr124 or Reck participate in Wnt/β-catenin signaling during these processes, by evaluating the expression of Wnt/β-catenin reporter transgenes. We could detect Tg(7xTCF-Xla.Siam:GFP) expression in a subset of wild-type ECs of the PHBCs starting at 26 hpf. Gradually, both the intensity and the number of GFP+ cells increased and these cells contributed to the PHBC, BA, and CtAs of 48 hpf wild-type embryos. In contrast, no GFP+ ECs could be detected in the PHBC or BA after gpr124 or reck knock-down (Figure 3A), while the expression of the 7xTCF-Xla.Siam:GFP transgene appeared unaffected in the surrounding neural tissues in the absence of Gpr124 or Reck. Examination of an endothelial-specific Wnt/β-catenin reporter transgene, in which the fusion of the DNA binding domain of Gal4 to the β-catenin binding domain of TCF4 acts as a sensor for nuclear β-catenin, confirmed that Gpr124 and Reck are both required for Wnt/β-catenin signaling in the PHBCs (Figure 3B). Similarly, both proteins are required to establish Tg(7xTCF-Xla.Siam:GFP) expression in the forming DRGs at 54 hpf (Figure 3C). We next tested whether Wnt/β-catenin signaling inhibition could mimic the phenotypes induced by Gpr124 or Reck depletion. Global heat-shock induced expression of Dickkopf1, the secreted inhibitor of Wnt/β-catenin signaling or Axin1, a component of the GSK-3/Axin/APC β-catenin destruction complex, induced respectively a partial and near-complete inhibition of brain vascular development. Similarly, pharmacological inhibition of Wnt/β-catenin signaling by the Axin-stabilizing compound IWR-I dose dependently blocked brain vessel formation (Figure 3D). DRG neurogenesis was similarly sensitive to Axin1 overexpression (Figure 3E). These observations suggest that the downregulation of Wnt/β-catenin signaling in Gpr124 or Reck deficient embryos could explain their angiogenic and neurogenic defects. We tested this hypothesis by artificially restoring β-catenin levels through GSK-3β inhibition using structurally distinct compounds. These drugs could partially restore brain angiogenesis (Figure 3F) and completely restore DRG neurogenesis (Figure 3G) in gpr124 morphants.

11In a previous study, we found that mouse Gpr124 co-activates Wnt/β-catenin signaling via Wnt7a/Wnt7b in a reporter cell line (Super Top Flash; STF) and that signaling was further enhanced by co-transfection with Fz4 and Lrp5. (We note that RNAseq analysis of STF cells showed low level expression of many Wnt signaling components, including Frizzled receptors, Lrp co-receptors, Gpr124, and Reck, which likely accounts for the signals observed when individual components are omitted from the transfection.) To determine whether Reck influences the Gpr124 dependence of Wnt7a- and Wnt7b-induced signaling, we co-transfected various combinations of Wnt7a or Wnt7b, Fz4, Lrp5 or Lrp6, Gpr124, and Reck into STF cells (Figure 4A). These experiments showed that Reck dramatically synergizes with Gpr124 in activating Wnt/β-catenin signaling in response to Wnt7a and Wnt7b, and that signaling is further increased by co-transfection with Fz4 together with Lrp5 or Lrp6. Both Gpr124 and Reck show well behaved dose–response curves, with synergistic activity over a wide range of DNA concentrations (Figure 4B).

12To test whether the combination of Reck and Gpr124 can co-activate signaling by Wnts other than Wnt7a and Wnt7b, we screened all 19 Wnts and Norrin for co-activation by Gpr124 alone, Reck alone, or Gpr124 plus Reck (Figure 4D, Figure 4—figure supplement 1B, C). This experiment shows that the highest co-activation with Gpr124 plus Reck occurs with Wnt7a and Wnt7b, with other Wnts and Norrin showing little or no response. An analogous comparison among the ten Frizzled receptors showed that Gpr124/Reck stimulates Wnt7a- and Wnt7b-mediated signaling by multiple Frizzleds (Figure 4C, Figure 4—figure supplement 1A). The data predict that cells expressing Gpr124, Reck, Lrp5 and/or Lrp6, and any of multiple Frizzleds will be responsive to Wnt7a or Wnt7b.

13In earlier experiments, we observed that Gpr124 co-activation of Wnt7a- and Wnt7b-dependent signaling in STF cells could be stimulated by Lrp5 but not by Lrp6, and we postulated that one or more additional proteins might be required to enhance signaling in the presence of Lrp6. The present experiments identify Reck as the missing protein since signaling in the presence of Reck can be stimulated by both Lrp5 and Lrp6 (Figure 4A), and they provide functional evidence that Gpr124 and Reck are major determinants of both the amplitude and ligand specificity of Wnt/β-catenin signaling.

14To examine whether the functional interactions between Gpr124, Reck and the Fz/Lrp5/6 complex reflect a multi-component membrane receptor complex involved in Wnt7 binding, their subcellular localization was investigated in 293 cells. We generated amino-terminal epitope-tagged version of Gpr124 (FLAG-Gpr124) and Reck (HA-Reck) and validated the biological activity of the fusion proteins in STF assays (data not shown) and brain vascular rescue experiments in zebrafish embryos (Figure 5A). When expressed in 293 cells, FLAG-Gpr124 and HA-Reck colocalized at the plasma membrane as revealed by indirect immunofluorescence assays (Figure 5B). Both Gpr124 and Reck reached and resided at the plasma membrane irrespective of the presence of the other (Figure 5B), and within this compartment they co-localized with GFP-tagged Fz4 (Figure 5—figure supplement 1). We next evaluated the proximity of Gpr124 and Reck through a highly sensitive in situ proximity ligation assay (PLA) which allows the localized detection of protein interactions. While PLA assays on 293 cells expressing either FLAG-Gpr124 or HA-Reck individually remained negative, simultaneous expression of the fusion proteins yielded extensive fluorescence hybridization signals at the cell surface (Figure 5C, D). As an additional control, the FLAG-Dvl2/HA-Reck protein pair, generated weaker and less frequent PLA signals, despite increased anti-FLAG immunoreactivity at the plasma membrane (Figure 5C). These observations, coupled with the synergistic capacity of Gpr124 and Reck to stimulate and confer ligand specificity to Wnt/β-catenin signaling in a Frizzled and Lrp5/6-dependent manner, are compatible with the assembly of a multi-component Wnt7 membrane receptor complex, whose precise stoichiometry and composition remains to be determined (Figure 5E, see also ‘Discussion’).

15In contrast to mouse, the size of zebrafish embryos allows oxygen to reach tissues independently of cardiovascular-based convection. We performed microarray gene expression analysis and found, in line with normoxic conditions, that the transcript levels of various vegf genes were not increased in the absence of Gpr124 at 48 hpf (Figure 6A). We took advantage of the unique normoxic nature of zebrafish embryos, combined with their optical clarity to investigate the requirements for Wnt/β-catenin during CNS angiogenesis at single-cell resolution.

16We first asked whether defective brain vascularization might result from insufficient EC abundance in the parental vessels. Using the endothelial-specific nuclear reporter Tg(kdrl:NLS-GFP), we determined EC number in the PHBC at 30 hpf and observed no difference between gpr124 mutants and their wild-type siblings (Figure 6B). As expected, marked differences were detected after the onset of brain invasion; while wild-type siblings accumulated intra-cerebral ECs contributing to the CtAs, gpr124 mutants maintained marginally higher numbers of cells in the PHBC, BA and most prominently in ventral connections between the PHBCs and the BA (Figure 6—figure supplement 1, Figure 1D, Videos 1 and 2). Mammalian CNS vessels show extensive pericyte coverage and these support cells convey essential properties to the BBB. To determine whether EC-pericyte interactions were compromised in gpr124 mutants, we generated a Pdgfrb transgenic reporter line TgBAC(pdgfrb:mCitrine) that labels perivascular cells presenting all characteristics of bona fide pericytes. We found extensive vascular wall coverage in both the presence and absence of Gpr124 function (Figure 6C). We then examined EC behaviors using time-lapse confocal microscopy in wild-type and Wnt/β-catenin-deficient vessels during CNS angiogenesis. Dynamic filopodial extensions were observed from the PHBC of both wild-type and gpr124 mutants embryos (Figure 6D, Videos 3–5), but only in wild-type siblings did those extensions progress dorsally to allow the cell body of a stereotypic tip cell to emerge from extra-cerebral vessels and invade the brain tissue. Intra-cerebral EC nuclei were absent in gpr124 mutants (Videos 6 and 7). Similar results were seen upon Reck knockdown as well as Wnt/β-catenin inhibition by heat-shock induced Axin1 overexpression.

17Polar filopodial extensions and abluminal emergence of ECs from pre-existing vessels are easily detectable angiogenic events occurring after the VEGF/Notch-controlled specification of presumptive tip and stalk cells within the parental vessel. We sought to distinguish between a defect in filopodial extension and an earlier event occurring within the parental vessel, by contrasting F-actin structures within the pre-angiogenic PHBCs of wild-type and gpr124 mutant embryos using a novel Tg(kdrl:lifeact-EGFP) line that labels filamentous actin in ECs. While the use of this transgene confirmed the presence of filopodial extensions independently of Gpr124 function, wild-type siblings in addition displayed actin-rich structures at the dorsal wall of the PHBCs at sites where angiogenic tip cells later emerged. These structures were not observed in gpr124 mutants, indicating that Gpr124 regulates actin cytoskeletal rearrangement within extra-cerebral ECs before the onset of brain invasion (Figure 6E).

18These observations are consistent with a defect in tip cell specification or behavior within the PHBCs of gpr124 mutants. To test this hypothesis, we generated genetically mosaic PHBCs by cell transplantation at mid-blastula stages and examined the behavior of wild-type Tg(kdrl:GFP) ECs in the context of Tg(kdrl:ras-mCherry) gpr124, reck or Wnt/β-catenin deficient endothelial neighbors (Figure 7A, B). Time-lapse imaging (Video 8 and stills presented in Figure 7A) revealed that mosaic PHBCs were competent for brain vascular invasion and that in all sprouts examined, tip cells were wild-type (green). Notably, trailing stalk cells could be wild-type (green) or Gpr124/Reck/Wnt/β-catenin-deficient (red) (red arrows in Figure 7A) revealing a tip cell-autonomous role for Gpr124/Reck/Wnt/β-catenin signaling during brain angiogenesis. A single wild-type cell was sufficient to instruct Wnt/β-catenin-deficient ECs to assemble mosaic vessels (Video 9). These mosaic sprouts invariably led by wild-type tip cells (Figure 7C) invaded the hindbrain in a wild-type manner and lumenized after connecting medially to the BA (Figure 7B, D). In contrast, when wild-type Tg(kdrl:GFP) cells were transplanted into Tg(kdrl:ras-mCherry) wild-type hosts, tip cell genotypes were randomized (Figure 7C). In mosaic ISV sprouts, gpr124 or reck loss of function did not impact tip cell genotype (Figure 7E, F). The mosaic cerebral vessels were maintained for several days with no indication of vascular instability during embryonic or early larval development (Figure 7G).

19The tip cell-restricted requirement for Gpr124 and Reck mediated Wnt/β-catenin signaling could conceptually be linked to a role in initiating a tip cell-permissive arterial-biased transcriptional program that is known to operate in the PHBCs during brain angiogenesis and that results notably in dll4 expression. At 36 hpf however, dll4 transcripts could be detected in the PHBCs irrespective of Gpr124 function (Figure 7—figure supplement 1) and accordingly, mosaic endothelial-specific overexpression of Dll4 was not sufficient to restore brain angiogenic competence to Gpr124-deficient PHBCs, while in a similar setting Gpr124-positive tip cells led new brain vascular sprouts (Figure 7—figure supplement 1).

20The principal results of the present study are: (1) characterization of the pattern of Wnt/β-catenin signaling in the developing zebrafish brain vasculature and the consequences of reduced Wnt/β-catenin signaling on brain angiogenesis, (2) identification of Reck, together with Gpr124, as integral components of a novel Wnt7a/Wnt7b-specific receptor complex in both zebrafish and mammals, and (3) discovery of a distinctive requirement for Wnt/β-catenin signaling in tip cells during brain angiogenesis.

21During retinal vascular development in mouse, wild-type ECs can instruct Fz4−/− ECs to assemble into mosaic vessels, suggesting that Wnt/β-catenin signaling is not a uniform requirement for all ECs during vascular network formation. The cellular basis of this phenomenon has, until now, not been investigated. Using genetic mosaics and live imaging, we present evidence that the control of brain vascular invasion by Wnt/β-catenin signaling operates at the level of the tip cells, and that stalk cells that are deficient in Wnt/β-catenin signaling can follow wild-type tip cells and contribute to the developing vasculature (Figure 7H). These observations reveal a heterogeneous requirement for Wnt/β-catenin signaling among ECs during brain invasion in zebrafish, and they predict a similar differential requirement between tip and stalk cells in the mammalian brain and retina.

22In recent years, through the investigation of a limited number of stereotypical in vivo settings, most notably the postnatal mouse retina and the zebrafish ISVs, a coherent model of sprouting angiogenesis integrating controlled behaviors of VEGF-selected tip cells and Notch-induced stalk cells within nascent vessels has emerged. A question of pressing interest is whether tissue and organ-specific angiogenic programs might refine our understanding of these processes. The Wnt/β-catenin-dependency of brain angiogenesis in zebrafish (Figure 3) coupled to their unique optical attributes has permitted us, through live imaging of mosaic animals (Figure 7), to collect evidence that local angiogenic programs can impact directly on the basic cellular behaviors of nascent angiogenic sprouts.

23An important focus for future studies will be to delineate the molecular mechanisms by which Wnt/β-catenin signaling affects tip cell specification and/or behavior. According to the current model, when pro-angiogenic signals stimulate a quiescent vessel, ECs that experience the highest level of VEGFA-VEGFR2 signaling become tip cells. As these nascent tip cells egress from the parental vessel, they accumulate tip cell-enriched transcripts, including dll4 and vegfr3, while neighboring cells become stalk cells through Notch-mediated lateral inhibition. The multiple interactions between the Wnt/β-catenin, Notch, and VEGFR signaling systems, as seen, for example, by the strong reduction of hindbrain CtAs after loss of VEGFR2 signaling or Notch activation, imply that regulation of brain vascularization is highly integrated.

24Despite current evidence for the tight integration of multiple signaling systems in EC development, our data argue that the tip cell requirement for Wnt/β-catenin signaling operates through a mechanism that does not simply reflect a global modulation of VEGF and/or Notch signals. In gpr124 mutants and reck morphants, a causal role for reduced VEGFR2 signaling in the PHBC appears unlikely because the formation of the BA from the PHBCs, which is known to be sensitive to VEGF inhibition, appears unaffected. We have also shown that at 36 hpf dll4 transcripts could be detected in gpr124 mutant PHBCs as in wild-type, and that clonal endothelial dll4 overexpression was not sufficient to restore the angiogenic behavior. With respect to Notch signaling, although gpr124 and reck-depleted cerebral vasculatures exhibit defects resembling those generated by pan-endothelial expression of a constitutively active Notch intracellular domain (NICD), gpr124 and reck morphant vascular defects were not rescued by dll4 knock-down or gamma-secretase inhibitor (DAPT) treatment.

25In our experiments, the Wnt reporter transgene labels both tip and stalk cells in nascent sprouts, as well as ECs in adult CNS vessels, reflecting the role of Wnt/β-catenin signaling in angiogenesis, BBB acquisition, and BBB maintenance. The multiple roles of Wnt/β-catenin signaling in endothelial development complicate the interpretation of experiments designed to discriminate between a permissive role for Wnt/β-catenin signaling during CNS angiogenesis vs a selective role in tip cell differentiation. For example, Wnt/β-catenin signaling could regulate a transcriptional program that is required for tip cell function but plays no role in tip cell selection or, alternatively, tip cells could be selected through a specific transcriptional program that is only initiated by a certain threshold level of Wnt/β-catenin activity. Although the present data do not distinguish between these two scenarios, we note that Wnt/β-catenin reporter expression does not begin uniformly within PHBCs at 26–28 hpf, but instead labels a small number of cells, and even at later stages (32 hpf), different levels of Wnt/β-catenin reporter expression are observed among PHBC ECs (Figure 3A). It is also notable that sprouting tip cells display high levels of Wnt/β-catenin reporter expression.

26Our discovery of Reck's central role in Wnt/β-catenin signaling is surprising because earlier work had implicated Reck in tissue remodeling via inhibition of MMP function at the transcriptional level, and at the level of protein–protein interactions. Down-regulation of RECK has been shown to correlate with enhanced tumor invasion, angiogenesis, and metastasis, and Reck−/− mouse embryos die in utero at around E10.5 with prominent vascular defects including vessel dilation, hemorrhaging, and arrested development of the primary vascular plexus. The mechanisms underlying these vascular defects have been unclear, but in light of the present work, a contribution of defective Wnt/β-catenin signaling seems possible.

27A question of central importance is the mechanism by which Gpr124 and Reck promote ligand-specific Wnt/β-catenin signal transduction. It is possible that Reck's role as an MMP inhibitor may contribute to its activity in the context of Wnt/β-catenin signaling. For example, Reck might protect ECM- or membrane-bound Wnt ligands and/or receptor complexes from proteolytic degradation, a possibility that would be consistent with its capacity to modulate Notch ligand ectodomain shedding through ADAM10 antagonism during cortical neurogenesis. In the context of this model, Gpr124 itself would be an attractive candidate for Reck-dependent regulation given previous evidence that MMP-processing of Gpr124 might affect its function. Arguing against this model is our failure to rescue reck morphant vascular or DRG phenotypes by treating embryos with various MMP or ADAM inhibitors (data not shown), in agreement with results from a previous study that examined Reck's role in DRG development. We note that Reck has additionally been implicated in endocytic trafficking, focal adhesion formation and cell polarity processes that may affect Wnt/β-catenin signal transduction.

28The striking similarities between Gpr124 and Reck loss-of-function phenotypes, together with their synergistic roles in Wnt7a/Wnt7b-specific activation of Wnt/β-catenin signaling, suggest a more focused view of Reck function. As an extension of a previous model for Gpr124 action, we propose that Reck and Gpr124 cooperate to activate Wnt/β-catenin signaling by selectively promoting Wnt7a/Wnt7b binding to cell surface receptor complexes, thereby (1) conferring specificity among Wnt ligands that would not otherwise be discriminated by Frizzled-binding, and (2) greatly enhancing the amplitude of Wnt7a and Wnt7b signals. Moreover, the observation that maximal Wnt/β-catenin signaling activity in Wnt7a/Wnt7b-stimulated cells requires the simultaneous presence of Gpr124, Reck, Fz, and Lrp5/Lrp6 (Figure 4), suggests that the Wnt7a/Wnt7b receptor complex might be composed of all four proteins (Figure 5E). An alternative model is suggested by the intriguing observation that Reck contains a cysteine-rich domain that is homologous to the Wnt-binding cysteine-rich domain of Frizzled receptors and by our demonstration that the intracellular domain of Gpr124 is functionally interchangeable with the homologous domain of Gpr125 which has been shown to bind the cytoplasmic Wnt signaling adaptor Dishevelled (; Figure 1F). Taken together, these two observations suggest that Gpr124 and Reck might be capable of signaling as an autonomous Wnt-binding receptor complex (Figure 5E).

29Vascular morphogenesis is a complex process that requires coordinated control of EC behaviors, including a separation of ECs into leading tip cells and trailing stalk cells. In addition, ECs must respond to organ-specific signals to meet the specialized needs of the vascularized tissue. By observing CNS angiogenesis in genetic mosaics at single-cell resolution, we have identified a regulatory system whereby endothelial Wnt/β-catenin signaling controls CNS angiogenesis through selective modulation of tip cell function. This Wnt/β-catenin signaling pathway requires the membrane proteins Gpr124 and Reck, further expanding the complexity of Wnt signal transduction mechanisms and holding the promise of new insights into the etiology and treatment of cerebral vascular defects, a major cause of morbidity and mortality.

30Zebrafish were maintained and embryos were obtained and raised under standard conditions. Establishment and characterization of the Tg(kdrl:GFP)s843, Tg(kdrl:ras-mCherry)s896, Tg(kdrl:NLS-GFP)zf109, Tg(hsp70l:dkk1-GFP)w32, Tg(hsp70l:Mmu.Axin1-YFP)w35, Tg(7xTCF-Xla.Siam:GFP)ia4, Tg(ngn1:gfp), Tg(UAS:EGFP), Tg(sox10:mRFP)vu234, Tg(kdrl:NLS-mCherry)is4 transgenic lines have been described elsewhere. The Tg(fli1:Gal4db-TΔC-2A-mC) was generated by fusing a cDNA fragment encoding the β-catenin binding domain of human TCF4E (amino acid 1–314) to the DNA binding domain of Gal4 followed by a 2A peptide and mCherry. It was subcloned into the pTol2-fli1 vector to generate the pTol2-fli1:Gal4db-TΔC-2A-mC plasmid. The Tg(fli1:Myr-mCherry) was generated by fusing an oligonucleotide encoding the myristoylation (Myr) signal derived from Lyn to mCherry in the pTol2-fli1 vector, yielding the pTol2-fli1:Myr-mC plasmid. The Tg(kdrl:Lifeact-EGFP)s982 line was generated following cloning of the F-actin binding Lifeact-EGFP downstream of a 6.8 kb kdrl promoter in pTol2. The TgBAC(pdgfrb:citrine)s1010 line was generated using a BAC clone containing the start codon of pdgfrb (CH73-289D6) using a pRedET based protocol. Tol2 LTRs were inserted into the vector backbone. Recombination was performed by amplifying a mCitrine-Kan(R) cassette using primers that contained 50bp of homology flanking the start codon: pdgfrb_HA1_mCitrine, TTTGGCTTTGAGGCGAATCAGTCATGTTGTTTTCTCTCCGTCTGCAGTGTACCATGGTGAGCAAGGGCGAGGAG and pdgfrb_HA2_Kan(R), TGGATGCGGCTGATGGTCGAACTCTTCATGCTTTCTTCTAGAGCAGGACATCAGAAGAACTCGTCAAGAAGGCG. Zebrafish transgenic lines were generated according to previously described protocols.

31All images were acquired using a Leica (Wetzlar, Germany) M165 stereomicroscope or a Zeiss (Oberkochen, Germany) LSM710 confocal microscope after embryo anesthesia with a low dose of tricaine and immobilization in 1% low-melting agarose in glass-bottom Petri dishes (MatTek Corporation, Ashland, MA). Time-lapse images were recorded every 10 min for a total period of 16 hr. The microscope stage was enclosed in a temperature-controlled chamber, and samples were kept at 28.5°C. The Sulfo-NHS-Biotin leakage assay was performed by intra-ventricular injection of 5 nL of 0.5 mg/mL EZ-link Sulfo-NHS-Biotin (Pierce; 0.5 kDa) in D-PBS, with the help of a micromanipulator, in animals treated with a low dose of tricaine. After 60 min, animals were anaesthetized with an overdose of tricaine, and the brains and livers were dissected and fixed in 4% PFA overnight at 4°C before embedding in 4% agarose. Vibratome sections of 150 μm thickness were permeabilized in 0.4% PBT (Triton X-100) and blocked in 4% PBTB (BSA). Primary and secondary antibody staining was performed at 4°C overnight. The following primary antibodies were used: anti-GLUT1 (NB300-666; Novus Biologicals, Littleton, CO), anti-P Glycoprotein [C219] (ab3364; Abcam, Cambridge, UK). Biotin was detected with Alexa Fluor 647 streptavidin. In all confocal images and time points, brightness and contrast were adjusted linearly and equally. Three-dimensional reconstructions were done with the Imaris FilamentTracer software (Bitplane, Zurich, Switzerland) in automatic detection mode before manual false-coloring and editing to highlight extra- and intra-cerebral vessels.

32Two TALENs targeting exons 7 and 16 of gpr124 were designed and cloned using Golden Gate assembly into the pCS2TAL3RR or pCS2TAL3DD expression vectors. The TALEN targeting exon 7 was composed of the following TAL effector domains RVDs: NN HD NI HD NI HD NI NG NG NN NG HD NN NG NG NI NG and HD HD HD NG NG NI NI NI NI NI HD NI NI HD HD NG. The TALEN targeting exon 16 was composed of the following TAL effector domains RVDs: HD HD NI NG NN NG NG NN HD NI NI NG NN NI HD NN NG and NI NG HD HD NG NN NG HD NI NN NI NN NG NN NI NG NN HD HD NG. One-cell stage embryos were injected with 50 pg total TALEN capped messenger RNA synthesized using the mMESSAGE mMACHINE kit (Ambion, Carlsbad, CA). Mutant alleles were identified by high-resolution melt analysis of PCR products generated with the following primers: gpr124-exon 7-Fo: AGGGTCCACTGGAACTGC; gpr124-exon 7-re: CAATGGAAAGGCAGCCTG; gpr124-exon 16-Fo: GCACACTCTCCTGAACACTAG; gpr124-exon 16-Re: TGCCTGGCATACAATTGGG.

33Capped messenger RNA was synthesized using the mMESSAGE mMACHINE kit (Ambion, Carlsbad, CA). The following expression plasmids were generated and used in this study: full-length zebrafish gpr124 and gpr125 were amplified from 48 hpf cDNA and recombined into BamHI-XhoI digested pCS2 using In-fusion cloning (Takara, Mountain View, CA) with the following primers: gpr124-Fo: CTTGTTCTTTTTGCAGGATCCGCCACCATGTCGGGACCCTGCGTC; gpr124-Re: CTATAGTTCTAGAGGCTCGAGTTATACAGTCGTCTCGCTCTTCC; gpr125-Fo: CTTGTTCTTTTTGCAGGATCCGCCACCATGTCGGTGCTTTGCGTCC; gpr125-Re: CTATAGTTCTAGAGGCTCGAGCTACACAGTAGTTTCATGCTTCCAC. Full-length zebrafish reck was amplified from 48 hpf cDNA and recombined into BamHI-XbaI digested pCS2 using In-fusion cloning (Takara, Mountain View, CA) with the following primers: reck-Fo: CTTGTTCTTTTTGCAGGATCCACCATGAGCGGGTGTCTCCAGATC; reck-Re: ACGACTCACTATAGTTCTAGAGTCAGAGGTCAGAGGTCAGGG. gpr124/125 hybrids were generated by recombining two PCR fragments overlapping by 15 bp derived from the above mentioned constructs into BamHI-XhoI digested pCS2 using In-fusion cloning (Takara, Mountain View, CA). In hybrids 1 and 2, the hinge corresponds to amino acid 742/743 of Gpr124 (VLHP742/V743IYT) and amino acid 739/740 of Gpr125 (PLHP739/V740IYA). In hybrids 3 and 4, the hinge corresponds to amino acid 1034/1035 of Gpr124 (HHCF1034/K1035RDL) and amino acid 1029/1030 of Gpr125 (HHCV1029/N1030RQD). Splice-blocking morpholinos against erbb3b (TGGGCTCGCAACTGGGTGGAAACAA), sorbs3 (TTTCCGACAGGGAAAGCACATACCC), reck (CAGGTAGCAGCCGTCACTCACTCTC) and gpr124 (ACTGATATTGATTTAACTCACCACA) were obtained from Gene Tools (Eugene, OR) and injected at the one-cell stage at 0.5, 4, 1, and 2 ng, respectively, unless otherwise stated. Injection of a standard control morpholino (up to 8 ng) did not affect brain vasculature or DRG formation.

34Host one-cell stage Tg(kdrl:ras-mCherry)s896 embryos were injected with the indicated morpholinos. Donor Tg(kdrl:GFP)s843 and host embryos were dechorionated with pronase (1 mg/mL) for 5 min at 28°C in 1/3 Ringer solution supplemented with penicillin (50 U/mL)/streptomycin (50 µg/mL) before being incubated in agarose-coated dishes in the same medium. Twenty to 50 cells were removed from donor embryos at mid-blastula stages and transplanted along the blastoderm margin of age-matched host embryos which were subsequently grown at 28.5°C until the indicated stages. The contribution of GFP+ transplanted cells was assessed using a Leica M165 stereomicroscope and EC position within mosaic vessels was determined using confocal microscopy. Contribution of cells of defined genotype to the tip cell position was calculated as a percentage of the total number of mosaic CtAs or ISVs.

35An enhancer from the fli1a gene was used to direct endothelial transgenic expression. Expressing cells were visualized by fusing dll4 and gpr124 coding sequences to EGFP by a self-cleaving viral 2A peptide sequence. Transient mosaic endothelial overexpression was obtained by co-injecting 25 pg of Tol2 transposase mRNA and 25 pg of the pTol2-fli1:egfp, pTol2-fli1:gpr124-2A-EGFP, pTol2-fli1:dll4-2A-EGFP, pTol2-fli1:EGFP-2A-gpr124 or pTol2-fli1:EGFP-2A-dll4 constructs.

36Manually dechorionated embryos were heat-shocked at 26 hpf for 50 min by transferring them into egg water pre-warmed to 38°C or incubated with inhibitors starting at the 16-somite stage until the indicated developmental stage. The following chemical inhibitors were used: LiCl (100 mM), 1-AKP (1-Azakenpaullone; 2.5 μM), SB 216763 (50 μM), BIO (0.5 μM). LiCl was diluted in egg water, other drugs were prepared in 100% DMSO and diluted to the indicated concentration with egg water. As a control, volume-matched DMSO solutions in egg water were used.

37RNA was extracted from 20 Tg(kdrl:GFP)s843 gpr124 mutants and 20 wild-type siblings, cDNAs were amplified, labeled with Cy3 (gpr124 mutants) or Cy5 (wild-type siblings), and hybridized to the Agilent Zebrafish (V3), 4x44k Gene Expression Microarray.

38FLAG-Gpr124 and HA-Reck were generated by recombining two PCR fragments overlapping by 15 bp derived from the above mentioned constructs into BamHI-XhoI digested pCS2 using In-fusion cloning (Takara, Mountain View, CA). The FLAG peptide was inserted between the amino acid 48/49 of zebrafish Gpr124 and the HA peptide between the amino acid 23/24 of zebrafish Reck. The mouse Fz4-GFP and human FLAG-Dvl2 constructs were obtained from Addgene (Cambridge, MA). HEK 293T cells were transfected with Lipofectamine 2000 (Life Technologies, Carlsbad, CA) 1 day after seeding and were grown in IBIDI imaging chambers for 2 days before fixation for 15 min in 4% paraformaldehyde. Indirect immunofluorescence and proximity ligation assays were performed with the following antibodies: mouse monoclonal anti-FLAG M2 (F1804; Sigma-Aldrich, St. Louis, MO) diluted at 1/2500, purified polyclonal rabbit anti-HA (H6908; Sigma-Aldrich, St. Louis, MO) diluted at 1/250 and Alexa-conjugated secondary antibodies (Molecular Probes, Carlsbad, CA) diluted at 1/5000. PLAs were performed following the manufacturer's instructions (Sigma-Aldrich, St. Louis, MO). DAPI nuclear counterstaining was performed for 2 min at 5 µg/mL.

39The dll4 probe was generated with the following primers: dll4-ISH-Fo:GCAGCTTGGCTCACCTTTCTC and dll4-ISH-Re: TAATACGACTCACTATAGGGAGTCCTTTCTCCTGATGCCTGC and T7 was used for transcription and digoxigenin labelling. For whole-mount in situ hybridization, embryos were fixed in 4% paraformaldehyde overnight at 4°C and processed as described previously.

40STF cells were transfected with FuGeneHD (Promega, Madison, WI) 1 day after seeding in a 96-well tray and were harvested 2 days later. Assays were performed in triplicate, and the ratio of activities of firefly luciferase (expressed from a stably integrated reporter with seven tandem Lef/Tcf binding sites) to Renilla luciferase was determined for each well. Wnt signaling components were expressed from a CMV promoter. The following amounts of plasmid DNA were transfected per well. Figure 4A: Renilla luciferase (0.5 ng), Lrp5 or Lrp6 (2.5 ng), Wnt7a or Wnt7b (20 ng), Fz4 (20 ng), Gpr124 (20 ng), Reck (20 ng). Figure 4B: Renilla luciferase (0.5 ng), GFP (20 ng), Wnt7a (20 ng), Gpr124 (20 ng when held constant [right panel], or the indicated amount [left panel]), Reck (20 ng when held constant [left panel], or the indicated amount [right panel]). Figure 4C and Figure 4—figure supplement 1A: Renilla luciferase (0.3 ng), GFP (1.5 ng), Lrp5 or Lrp6 (1.5 ng), Wnt7a (3 ng), Gpr124 (0 or 15 ng), Reck (0 or 15 ng), and Frizzled (15 ng). Figure 4D: Renilla luciferase (0.5 ng), GFP (20 ng), Gpr124 (0 or 20 ng), Reck (0 or 20 ng), Wnt, Norrin, or vector control (20 ng). The mouse Reck cDNA (GE Dharmacon; clone BC138065, Lafayette, CO) differs from the reference sequence in the NCBI database by a single amino acid substitution (Thr757 in the cDNA instead of Lys757 in the NCBI database); human Reck has Thr at the corresponding location.

41Statistical analysis was performed using GraphPad software. Data presented in bar graphs represent mean ± SD. p-values were calculated by the one-way ANOVA (post hoc Tukey's test) and Student's t test for multiple and single comparisons of normally distributed data (D'Agostino & Pearson omnibus normality test), respectively and by the Kruskal–Wallis (post hoc Dunn's test) and Mann–Whitney test for multiple and single comparisons of non-normally distributed data, respectively. p-values of tip cell genotype in mosaic vessels (Figure 7) were determined by the exact Fisher test. (*p < 0.05; **p < 0.01).