Myosin VIII associates with microtubule ends and together with actin plays a role in guiding plant cell division

1To divide, plant cells must build a new cell wall. This is accomplished by a dynamic and complex structure known as the phragmoplast, comprising the cytoskeletal polymers, microtubules and actin filaments. The phragmoplast assembles from the anaphase spindle and directs the traffic of vesicles carrying cell wall components to and from the nascent wall, called the cell plate. The phragmoplast forms at the center of the cell and expands outward to reach the parental cell wall, tens or even hundreds of microns distant. When the phragmoplast reaches the parental cell wall, the cell plate and parental membranes fuse, completing cytokinesis.

2Active guidance is required during phragmoplast expansion. However, the molecular basis for this steering has been elusive. It is clear that microtubules are essential for cell division, since in their absence the cell plate does not form. And while it has been known for decades that the phragmoplast also contains actin filaments, it remains unclear how actin contributes to phragmoplast function. For one, plant cells still divide in the absence of actin. Additionally division still occurs in the presence of mutations in genes encoding actin or various actin-associated proteins. However, based on drug treatments and localization studies, actin has been proposed to stabilize the phragmoplast and link the phragmoplast to the cell cortex. But beyond implicating actin in a steering mechanism somehow, these studies have provided little if any mechanistic details.

3Specifically dissecting the role of phragmoplast actin is further complicated because actin is also present at the preprophase band, a microtubule-based structure that is present on the cell cortex just prior to nuclear envelope breakdown. As mitosis proceeds, the microtubules in the band disassemble while actin filaments become depleted from the band itself but enriched on either side of it. Although the cytoskeletal polymers are lost from the band, a number of proteins remain at the site of the band throughout mitosis and cytokinesis, thereby marking the site where the new cell plate will fuse to the parental cell wall. Interfering with preprophase band development invariably interferes with cell plate positioning. Because actin is present in both the band and the phragmoplast, discovering actin's function specifically in the latter has been challenging.

4However, not all dividing plant cells have a preprophase band. Moss spores germinate into a branched network of filaments, known as protonemata. All dividing cells, both apical and branching, divide without benefit of a preprophase band. While depolymerization of the actin cytoskeleton halts cell expansion in protonemata, it has little if any effect on cell division. The fact that moss protonemata do not make a preprophase band, but have actin in the phragmoplast provides a unique opportunity to study the role of actin in phragmoplast guidance. Here, we use a combination of genetics and live-cell imaging to probe the role for guiding the phragmoplast of actin and a family of actin-based molecular motors, the class VIII myosins.

5Physcomitrella patens has five identified class VIII myosin genes, named myo8A through E. Taking advantage of facile homologous recombination in this species, constructed a line in which all five genes were disrupted (Δmyo8ABCDE). Protonemata from this line have multiple, unevenly distributed branches. Upon further inspection, we found that cell plate placement at branch sites is often affected (Figure 1A). Cell plates are aberrantly positioned with respect to the filament axis (Figure 1A, arrows). Since branch patterning and cell division plane specification are linked, we reasoned that non-branching cells in the myosin VIII null plants might also have cell division defects. In young wild-type plants, apical cells position their new cell plates perpendicular to the long axis of the cell: more than 84% of apical cell plates are within 15° of the perpendicular plane. In contrast in myosin VIII null plants, less than 35% of the apical cell plates are within 15° of the perpendicular axis and nearly 40% have cell plates with angles greater than 25°, some as high as 45° (Figure 1B).

6To investigate how myosin VIII regulates cell plate positioning, we generated a construct encoding Myo8A fused to three tandem copies of monomeric enhanced GFP (hereafter referred to as Myo8A-GFP) and transformed Myo8A-GFP into the myosin VIII null plant. Since myosin VIII's are partially redundant, we reasoned that expression of Myo8A should be sufficient to partially rescue the myosin VIII null phenotype. To test this, we measured cell plate positioning in young plants and found that expression of Myo8A-GFP results in plants with 63% of the apical cell plates within 15° of the perpendicular axis. Importantly, cell plates with angles greater than 35° are never observed in the Myo8A-GFP expressing plants (Figure 1B), indicating that Myo8A-GFP partially restores cell plate positioning in the myosin VIII null plants. Additionally, Myo8A-GFP expression partially rescues a number of other defects in myosin VIII null plants, including protonemal branching defects (Figure 1C), apical cell length (Figure 1D), and timing of gametophore formation (data not shown). Taken together, our data indicate that Myo8A-GFP is functional.

7Myo8A-GFP localizes diffusely and as small particles throughout the cytoplasm (Figure 2A) as well as at the cell cortex (Figure 2B). In apical cells Myo8A-GFP particles are enriched at the cell tip (Figure 2A). Using variable angle epifluorescence microscopy (VAEM), we simultaneously imaged Myo8A-GFP and actin labeled with lifeact-mCherry. We observed that Myo8A-GFP cortical particles appear to move along actin filaments, consistent with actin-based motility (Figure 2B; Video 1). Movement was observed in both directions along an actin cable (Figure 2C). We measured the velocity of the particles and found that Myo8A-GFP moves at 0.65 ± 0.57 µm/s (n = 249 particles from 7 cells, Figure 2E, Figure 2—figure supplement 1). In the presence of 25 µM latrunculin B (LatB), which depolymerizes the actin cytoskeleton, Myo8A-GFP still localizes to the cell cortex but no longer exhibits directed motility (Figure 2D; Video 2), as expected for an active, actin-based molecular motor.

8To investigate the role of myosin VIII in cell division, we first examined the localization of Myo8A-GFP in divisions that form branches since the myosin VIII null plants have a strong phenotype in branching cells. To stage division, we introduced into the Myo8A-GFP line mCherry-PpTUA1 (hereafter referred to as mCherry-tubulin). In branch forming cells, Myo8A-GFP accumulates prominently at the cell cortex at the neck region of the emerging bulge, and this accumulation happens prior to prophase (Figure 3 arrows; Figure 3—figure supplement 1; Video 3). The tubulin images confirm that these cells lack a preprophase band. During branch cell mitosis, Myo8A-GFP appears on the spindle and phragmoplast, and as the phragmoplast matures, Myo8A-GFP accumulates at the phragmoplast periphery. In the later stages of cytokinesis, there are two populations of Myo8A-GFP: an inner ring on the phragmoplast (Figure 3, arrow heads; Figure 3—figure supplement 1) and an outer ring at the cell cortex (Figure 3, arrows; Figure 3—figure supplement 1). As the phragmoplast expands, the inner Myo8A-GFP ring eventually reaches the outer one. Together with an increased frequency of cell plate positioning defects in myosin VIII null plants, these data suggest that myosin VIII plays a role in ensuring that the phragmoplast expands to the pre-determined cortical division site.

9To investigate whether myosin VIII has a similar role in seed plants, we generated a tobacco BY-2 cell line stably transformed with the moss Myo8A-GFP. BY-2 cells are commonly used to study the localization of plant proteins during mitosis and cytokinesis. Alignment of myosin VIII proteins from tobacco, Arabidopsis and moss, revealed that moss myosin VIII proteins are ∼50% identical to tobacco and Arabidopsis myosin VIIIs (Figure 4—source data 1, 2). Except for the closely related tobacco and Arabidopsis Myo8B and D, the percent identity between the remaining four tobacco and Arabidopsis myosin VIIIs is 51–58% (Figure 4—source data 1 and 2). With such high sequence identity, we reasoned that Myo8A-GFP might serve as a proxy for the localization of seed plant myosin VIIIs.

10We found that similar to the interphase localization described above for moss, Myo8A-GFP localizes in tobacco to dynamic cortical particles (Figure 4A; Video 4). In cells about to enter mitosis, cortical Myo8A-GFP accumulates at the presumptive position of the preprophase band (Figure 4B). As cells enter mitosis, cortical Myo8A-GFP tightens into a thin band and remains at the cortical division site. In early cytokinesis, Myo8A-GFP appears also at the phragmoplast midzone (Figure 4C). As the phragmoplast expands, the Myo8A-GFP at the phragmoplast midzone expands out eventually reaching the Myo8A-GFP at the cortical division site (Figure 4D; Video 5). Evidently, myo8A-GFP is capable of localizing to the phragmoplast and future site of division in a seed plant as well as in a bryophyte.

11Because division in apical cells is more frequent than in branching cells, we imaged moss apical cells to investigate the mechanism of myosin VIII function during phragmoplast expansion. Before nuclear envelope break down, we found a population of Myo8A-GFP that localizes to cytoplasmic microtubules surrounding the nucleus (Figure 5A). Myo8A-GFP remains localized along microtubules as the spindle is assembled (Figure 5B; Video 6). During mitosis, Myo8A-GFP continues to associate with the mitotic spindle (Figure 5C; Video 7), enriched at the midzone and to some extent at the poles. Prior to anaphase, a small population of Myo8A-GFP accumulates at the cortex near the spindle midzone (Figure 5C, arrows; Video 7). During anaphase, Myo8A-GFP concentrates at the midzone. Initially Myo8A-GFP is found throughout the phragmoplast midzone (Figure 5C—figure supplement 1). As the phragmoplast matures, Myo8A-GFP accumulates on the leading edge of the phragmoplast, ultimately forming a ring (Figure 5C, Figure 5C—figure supplement 1; Video 7). Interestingly in apical cells, Myo8A-GFP does accumulate at the cell cortex, but in contrast to branching cells, this accumulation occurs later and is significantly more dynamic.

12To test whether actin is involved in recruiting Myo8A-GFP to the mitotic spindle, we first imaged Myo8A-GFP and lifeact-mCherry in dividing cells (Figure 6A; Video 8, top). When Myo8A-GFP appears on the spindle, there is little to no accumulation of lifeact-mCherry. During the transition from spindle to phragmoplast, Myo8A-GFP concentrates at the midzone and lifeact-mCherry fluorescence rises above background levels in the vicinity of the phragmoplast. However, when Myo8A-GFP fluorescence tightens into a thin band on the phragmoplast leading edge, the lifeact-mCherry fluorescence accumulates significantly around the phragmoplast (Figure 6A; Video 8, top). The timing of the appearance of actin suggests that early localization of Myo8A-GFP to the mitotic spindle is independent of actin. To test this, we imaged cells entering mitosis in the presence of 25 µM Latrunculin B, which depolymerizes the actin cytoskeleton (Figure 6—figure supplement 1). Strikingly, Myo8A-GFP still accumulates on the mitotic spindle. Similar to control cells, Myo8A-GFP in drug-treated cells accumulates in the spindle midzone at anaphase and tightens into a thin band at the leading edge of the phragmoplast during cytokinesis (Figure 6B; Video 8, bottom). Thus, Myo8A-GFP recruitment to the mitotic spindle and behavior during mitosis is apparently independent of actin.

13The fact that Myo8A-GFP localization is scarcely changed in the absence of actin raises the possibility that myosin VIII functions independently of actin. To test this, we imaged phragmoplasts labeled with GFP-tubulin and FM4-64. Since actin is essential for polarized expansion, it was not possible to perform long-term Latrunculin B treatments. Instead, plants were treated for 2 hr before imaging, ensuring that essentially all observed phragmoplasts had been formed in the absence of actin. The majority of untreated, wild-type phragmoplasts deposit membrane uniformly, appearing as smooth FM4-64 staining in the midzone (80% of wild type cells, n = 55; Figure 7A; Video 9,). In contrast, most myosin VIII null dividing cells have non-uniform FM4-64 staining (70% of Δmyo8ABCDE cells, n = 79; Figure 7B; Video 10). Interestingly, treatment of wild type dividing cells with Latrunculin B results in cells with similar defects in cell plate assembly as those observed in the myosin VIII null cells (70% of wild type cells treated with LatB, n = 50; Figure 7C; Video 11), indicating that the observed changes in the assembling cell plate result from compromising actin and myosin.

14During phragmoplast expansion, the vast majority of microtubules are tightly focused at the phragmoplast midzone, where there is a strong accumulation of Myo8A-GFP. However, we also observed that Myo8A-GFP localizes to the ends of peripheral phragmoplast microtubules (Figure 8A,B, arrows; Video 12) that initiate from the edge of the phragmoplast and are initially unattached to the phragmoplast midzone. We investigated the behavior of these peripheral microtubules in control and latrunculin B treated cells (Figure 8; Video 12). Before the phragmoplast reaches the cell cortex, we found that there were three times fewer peripheral microtubules in control cells as compared to cells treated with latrunculin B. We suspected that this difference likely results from the fact that peripheral microtubules more rapidly focus at the phragmoplast midzone in control cells. To test this, we identified peripheral microtubules in control and latrunculin B treated cells and followed them for 20 s. We found in control cells that only 20% of the peripheral microtubules were still present after 20 s (n = 4 cells). In contrast, 89% of peripheral microtubules were still present after 20 s in latrunculin B treated cells (n = 4 cells). In some cases (Figure 8D, yellow arrow) peripheral microtubules were observed to remain unattached for more than a minute. Taken together these data indicate that in the presence of actin peripheral microtubules are swiftly integrated into the expanding phragmoplast, suggesting that actin filaments exist between the edge of the expanding phragmoplast, peripheral microtubules, and the cell cortex.

15In support of this, we found that an actin nucleator, For2A-GFP, is enriched on the phragmoplast as soon as it forms from the late spindle (Figure 9A; Video 13). For2A-GFP remains on the edge of the phragmoplast throughout cytokinesis (Figure 9B; Video 14), suggesting that actin is actively polymerized on the phragmoplast edge. To test this, we simultaneously imaged lifeact-mEGFP and mCherry-tubulin using a laser scanning confocal microscope. We confirmed that actin accumulates at the midzone once the phragmoplast forms. As the phragmoplast expands out from the center of the cell towards the cell cortex, we discovered that actin filaments are present at the midzone and between the leading edge of the phragmoplast and the cell cortex (Figure 9C; Video 15). Moreover, peripheral phragmoplast microtubules intersect the actin filaments that span the distance between the phragmoplast leading edge and the cell cortex (Figure 9C, arrowhead). Our data suggest that microtubules may interact with actin filaments bridging the cell cortex and the phragmoplast during the time that myosin VIII-mediated motility guides the phragmoplast.

16Based on our data, we propose the following model for myosin VIII function in phragmoplast guidance during division of a protonemal apical cell (Figure 10). A population of myosin VIII localizes to microtubules and this population incorporates into the mitotic spindle upon spindle formation. In early mitosis, as microtubules are dynamically searching to make chromosomal attachments, Myo8A-GFP decorates the entire spindle (Figure 5B). At metaphase, Myo8A-GFP concentrates in the spindle midzone and at anaphase an additional population of Myo8A-GFP dynamically concentrates at the cell cortex where the cell plate ultimately fuses with the parental cell wall. Once the phragmoplast assembles, Myo8A-GFP forms a tight ring at the edge of the expanding phragmoplast (Figure 5). At this point, the class II formin, For2A, localizes to the phragmoplast (Figure 9B; ) and polymerizes actin filaments between the leading edge of the phragmoplast and the cell cortex (Figure 9C). Since For2A remains associated with the phragmoplast, it suggests that the barbed ends of the actin filaments are anchored at the phragmoplast midzone and the pointed ends are in the cytoplasm. Myosin VIII at the cortex can hold onto these actin filaments and walk towards the barbed end thereby aligning the actin filaments to the cortical division site. We propose that myosin VIII at the ends of peripheral phragmoplast microtubules moves along these actin filaments from the cortical division site towards the expanding phragmoplast, thereby translocating microtubules and ensuring that phragmoplast expansion occurs along a plane defined by the cortical division site (Figure 10).

17There is precedent for myosin-based motility translocating microtubules on actin filaments. In the budding yeast, Saccharomyces cerevisiae, the class V myosin, Myo2p, binds Kar9p, which localizes to cytoplasmic microtubule plus ends by binding the yeast EB1 homolog, Bim1p. These cytoplasmic microtubules emanate from the spindle pole body embedded in the nuclear envelope and Myo2p mediates their motility along actin cables directed into the bud, moving the nucleus toward the bud neck. We imagine a similar mechanism could be at work in plant cells, whereby myosin VIII associates with microtubule ends, and subsequently translocates microtubules on actin filaments to guide phragmoplast expansion.

18While the localization of myosin VIII is striking, myosin VIII in protonemata is mostly dispensable for phragmoplast guidance in apical cells. These cells are narrow, with diameters not much greater than the sizes of the nucleus and spindle, leaving little room for those two structures to be misplaced. Due to these geometric constraints, the mitotic spindle always forms along the long axis of the cell. Thus, any cell plate positioning defects that occur are mild because the spindle midzone is always roughly perpendicular to the long axis of the cell.

19In contrast, myosin VIII is needed for branch formation, insofar as cell plates are often aberrantly positioned in the branching cells of the myosin VIII nulls. Arguably, in comparison to apical cell division, side-branch formation needs to specify the cell division plane more accurately. Branching involves an asymmetric cell division in an L-shaped cell. The nucleus migrates toward the junction of the parental cell and the branch and the spindle is oriented along the longitudinal axis of the new emerging cell. The phragmoplast builds the new cell plate at the junction of the two cells. We found that in branching cells, a relatively static population of Myo8A-GFP accumulates at the cell cortex at the future site of cell division (Figure 3). Myo8A-GFP accumulates at this site early, prior to mitosis, and remains throughout cytokinesis. As in apical cells, Myo8A-GFP also accumulates on the mitotic spindle, ultimately forming a tight band on the leading edge of the phragmoplast. The new cell plate fuses with the parental cell membranes at the cortical site defined by the presence of Myo8A-GFP. Since there are many ways to orient the spindle in a branching cell, in the absence of myosin VIII defects in cell plate positioning are frequent, suggesting that myosin VIII functions to guide phragmoplast expansion.

20Notably, our data suggests that a myosin VIII-mediated phragmoplast-guidance mechanism also exists in seed plants, since we found that moss Myo8A-GFP localizes to the preprophase band, cortical division site, and the phragmoplast midzone in BY-2 cells (Figure 4). Our result is consistent with a previous report in which a GFP fusion of one of the Arabidopsis class VIII myosins, ATM1-GFP, was shown to localize to the phragmoplast in BY-2 cells. The discovery that Myo8A-GFP localizes to the cortical division site gives us a portal to connect our observations in moss to the current model of cell division in seed plants. In that model, cells with preprophase bands use a microtubule-dependent mechanism to position the nucleus such that it is bisected by the future plane of division and to form the spindle perpendicularly. Once the spindle is aligned, defects in phragmoplast guidance would little alter cell plate positioning and subsequent tissue morphogenesis, obscuring the role of myosin VIII. Nevertheless, when BY-2 cells are treated with actin inhibitors, phragmoplasts are disorganized, generating wrinkled cell plates that are often skewed with respect to the cortical division site. Thus, we predict that for fine tuning myosin VIII and actin guide phragmoplast expansion in cells with preprophase bands.

21Our data provide evidence that myosin VIII and actin steer phragmoplast expansion during cytokinesis in both moss and tobacco, suggesting that myosin VIII function is conserved throughout plant evolution. In fact, myosin VIII provides a physical link between phragmoplast microtubules and the cortical division site via actin filaments. We propose that myosin VIII's motor activity along actin provides a molecular mechanism for steering phragmoplast expansion.

22All expression constructs were constructed using Multisite Gateway recombination technology from Invitrogen (Carlsbad, CA). Generation of entry clones 3XmEGFP-L5L2 (29), Lifeact-L1R5 (30) and mCherry-L5L2 (15) were described previously. To construct the entry clone Myo8A-L1R5, total RNA was extracted from 7-day-old moss protonemal tissues using RNeasy plant mini kit (Qiagen), followed by DNase I treatment according to the manufacturer's protocol. cDNA was synthesized from total RNA using SuperScript II reverse transcriptase (Invitrogen) and oligo (dT) according to manufacturer's protocol. Full length Myo8A coding sequence was amplified from moss cDNA using Myo8A specific primers (P1 & P2), and cloned into pGEM-T easy from Promega (Madison, WI). The full-length Myo8A coding sequence was then amplified from the pGEM-Myo8A clone using primers (P3 & P4) containing attB1 and attB5r sites, and cloned into pDONR-P1P5r with a BP reaction (Invitrogen). The mCherry and mEGFP coding sequence was amplified using primers (P5 & P6) with attB1 and attB5r sites and cloned into pDONR-P1P5r to generate entry clones mCherry-L1R5 and mEGFP-L1R5. Moss α−tubulin coding sequence was amplified from pAct-GFP-TUA1 (31) with primers (P7 & P8) containing attB5 and attB2 sites and cloned into pDONR-P5P2 to generate entry clone α-tubulin-L5L2. Combinations of entry clones were assembled with destination vectors generating constructs for stable expression in moss or tobacco BY-2 cells using LR clonase II plus reactions (Invitrogen) as follows: Myo8A-L1R5 and 3XmEGFP-L5L2 with pTKUbi-gate generating pTKUbi-Myo8A-3mEGFP; Lifeact-L1R5 and mCherry-L5L2 with pTZUbi-gate generating pTZUbi-Lifeact-mCherry; TUA1-L5L2 and mCherry-L1R5 with pTZUbi-gate generating pTZUbi-mCherry-tubulin; TUA1-L5L2 and mEGFP-L1R5 with pTKUbi-gate generating pTKUbi-mEGFP-tubulin; Myo8A-L1R5 and 3XmEGFP-L5L2 with pMDC32 (32) generating pMDC32-Myo8A-3XmEGFP.

23The pTKUbi-gate vector has an expression cassette derived from pTHUbi-Gate(33), which contains the maize ubiquitin promoter, Gateway cassette and NOS terminator. Following this expression cassette is a 35S::NptII::ter cassette flanked by lox sites(14). The expression and antibiotic resistance cassettes are flanked by moss genomic sequence from the Pp1s249_67V6.1 locus. Nucleotides −2 to −1153 and nucleotides 660 to 1757 are on the 5′ and 3′ ends, respectively, with Pme I sites incorporated such that digestion with Pme I releases the moss genomic DNA targeting arms as well as the expression and resistance cassettes. The pTZUbi-gate vector is similar except that it contains a 35S::Zeo::ter cassette flanked by lox sites (14) as the antibiotic resistance cassette, uses moss genomic sequence from the Pp1s141_25V6.1 locus (nucleotides +908 to +2021 and −35 to −1532), and has Swa I for release of the moss genomic DNA targeting arms and expression and resistance cassettes.

24The coding sequence of moss α-tubulin (Pp1s215_51V6 locus) was amplified from moss cDNA using primers P9 and P10 and cloned into pENTR/D-TOPO (Invitrogen). After verification by sequencing, the coding sequence was cloned into the L5L4-mCherry plasmid (modified with restriction sites C-terminal to the mCherry L5L4-mCherry-AscI-SpeI) using the restriction sites AscI and SpeI, generating L5L4-mCherry-αtub215-51-1. Sequences upstream and downstream of the locus were amplified as targeting sequences for homologous recombination. The 5' targeting sequence was amplified using primers (P11 & P12) and cloned into pDONR-P1P5r using BP Clonase II (Invitrogen), generating L1R5-αtub215-51-1-5′tarm. Similarly, the 3′ targeting sequence was amplified with primers (P13 & P14) and cloned into pDONR-P3P2 using BP Clonase II (Invitrogen), generating L3L2-αtub215-51-1-3′tarm. The L1R5-αtub215-51-1-5′tarm, L5L4-mCherry-αtub215-51-1 and L3L2-αtub215-51-1-3′tarm were recombined with R4R3 NOSter-Lox-Hygro-Lox (34) and pGEM-Gate (30) using LR Clonase II plus (Invitrogen) to generate the final construct for homologous recombination in moss, mCherry-αtub215-51-1AR.

25(P1) ATGTATTCTACGAATGGCATTGAGG; (P2) CTAACCTTGGAGCGCTCTTGAGG; (P3) GGGGACAAGTTTGTACAAAAAAGCAGGCTTCATGTATTCTACGAATGGC; (P4) GGGGACAACTTTTGTATACAAAGTTGTACCTTGGAGCGCTCTTGAGG; (P5) GGGGACAAGTTTGTACAAAAAAGCAGGCTTCATGGTGAGCAAGGGCGAGGAG; (P6) GGGGACAACTTTTGTATACAAAGTTGTCTTGTACAGCTCGTCCATGCC; (P7) GGGGACAACTTTGTATACAAAAGTTGTTATGAGAGAGATTATCAGCATCCAC; (P8) GGGGACCACTTTGTACAAGAAAGCTGGGTATCAGTAGTCGTCGTCCTCC; (P9) ACTAGTTTAGTACTCGTCGTCGTCCTGTCCTCCGTCGGTGGATTCAGC; (P10) GGCGCGCCATGAGAGAGATCATCAGTATCCATATAGGTCAGG; (P11) GGGGACAAGTTTGTACAAAAAAGCAGGCTCTGGCGCGCCACTTCATAATCTACCTGTGC; (P12) GGGGACAACTTTTGTATACAAAGTTGTGGAAGAGTACGAGCAGCAGC; (P13) GGGGACAACTTTGTATAATAAAGTTGTGGGCTTTTATTTTGAGGCGGAAACGG; (P14) GGGGACCACTTTGTACAAGAAAGCTGGGTAGGCGCGCCGTTAACTGTGGAGTTCTG; (P15) GCAATACAACACACTGTGCTTGGG; (P16) GGTGTTGAAAGCATCATCACCACC.

26All moss tissue culture, protoplasting and transformation were performed as described previously (15). Moss protonemal tissues were propagated weekly on PpNH4 medium (1.03 mM MgSO4, 1.86 mM KH2PO4, 3.3 mM Ca(NO3)2, 2.7 mM (NH4)2-tartrate, 45 μM FeSO4, 9.93 μM H3BO3, 220 nM CuSO4, 1.966 μM MnCl2, 231 nM CoCl2, 191 nM ZnSO4, 169 nM KI, and 103 nM Na2MoO4) containing 0.7% agar. For imaging, 1-week-old protonemal tissues were protoplasted, plated in plating medium at a density of ∼20,000 cells/9 cm2 plate, regenerated on protoplast regeneration medium (PRM) for 4 days and transferred to PpNH4 plates. For moss transformation, protoplasts were isolated from 7-day-old moss protonemal tissue, and transformed with linearized DNA via PEG-mediated transformation (15). At least 30 µg of plasmid DNA was linearized, ethanol precipitated, and dissolved in sterile TE buffer. pTKUbi constructs were linearized with Pme I and pTZUbi constructs were linearized with Swa I. Protoplasts were transformed with linearized DNA via PEG-mediated transformation (15). Protoplasts were plated in top agar, regenerated on PRM (PpNH4 medium supplemented with 8.5% mannitol and 10 mM CaCl2.) for 4 days and transferred to PpNH4 medium containing the appropriate antibiotics (G418, 20 µg/ml; zeocin, 50 µg/ml; hygromycin, 15 µg/ml). To select for stable transformants, transformations were cycled on and off antibiotic selection for three 1-week intervals. Stable transgenic lines were visually screened on a confocal microscope for expression of the transgene.

27pTKUbi-mEGFP-Tub was transformed into WT and Δmyo8ABCDE (14) generating the mEGFP-Tub lines. pTKUbi-Myo8A-3mEGFP was transformed into Δmyo8ABCDE generating the Myo8A-GFP line. Myo8A-GFP was subsequently transformed with pTZUbi-mCherry-tubulin and pTZUbi-Lifeact-mCherry to generate Myo8A-GFP/mCherry-tub and Myo8A-GFP/Lifeact-mCherry.

28Lifeact-mEGFP line (30) was transformed with the Asc I linearized mCherry-αtub215-51-1AR construct, to generate Lifeact-mEGFP/mCherry–tubulin line. Stably transformed lines were identified by visually screening for mCherry expression and then verified by genotyping using primers P15 and P16.

29Tobacco BY-2 tissue culture and Agrobacterium-mediated transformation were performed as previously described (35). Tobacco BY-2 cells were transformed with pMDC32-Myo8A-3XmEGFP. The GV3101 Agrobacterium tumefaciens strain was used for infection.

30For measurement of cell plate angle and apical cell length, plants regenerated from protoplasts were stained with 0.1 mg ml−1 calcofluor solution and visualized by epifluorescence microscopy (Leica MZ16FA, Leica Microsystems, Buffalo Grove, IL) using a UV filter (excitation 360/40 nm, emission 420 long pass) or a Violet filter (excitation 425/40 nm, emission 400 long pass). Cell plate angles and apical cell lengths were measured manually using ImageJ software.

31For imaging cell division, 5- to 8-day-old plants regenerated from protoplasts were placed unto an agar pad in Hoagland's (4 mM KNO3, 2 mM KH2PO4, 1 mM Ca(NO3)2, 89 μM Fe citrate, 300 μM MgSO4, 9.93 μM H3BO3, 220 nM CuSO4, 1.966 μM MnCl2, 231 nM CoCl2, 191 nM ZnSO4, 169 nM KI, 103 nM Na2MoO4, and 1% sucrose), covered by a glass cover slip and sealed with VALAP (1:1:1 parts of Vaseline, lanoline, and paraffin). For cell plate staining, 15 µM FM4-64 was added in the Hoagland's solution in the agar pad. For latrunculin B treatment, plants were transferred to PpNH4 medium containing 25 µM latrunculin B for 2 hr, then transferred to slides containing 25 µM latrunculin B in both the agar pad and the Hoagland's solution.

32Samples were mounted on an inverted microscope (model Ti-E; Nikon Instruments, Melville, NY) equipped with a mirror-based T-FL-TIRF illuminator (Nikon) and imaged with a 1.49 NA 100× oil immersion TIRF objective (Nikon). The 1.5× optivar was used for all images to increase magnification. 488 and 561 nm laser illumination was used for GFP and mCherry excitation, respectively. The laser illumination angle was adjusted individually for each sample to achieve the maximum signal-to-noise ratio. Signals for each channel were captured simultaneously with a 1024 × 1024 electron-multiplying CCD camera (iXON3; Andor Technology USA, South Windsor, CT) equipped with a dual-view adaptor (Photometrics, Tucson, AZ). Emission filters were 525/50 nm for GFP and 595/50 for mCherry. Image acquisition process was controlled by NIS-Elements AR 3.2 software (Nikon).

33The slides were mounted on an inverted microscope (model Ti-E; Nikon) equipped with a Yokogawa spinning disk head (model CSU-X1) and a 512 × 512 electron multiplying CCD camera (iXON; Andor Technology). Images for each channel were collected sequentially with a 1.4 NA 100× oil immersion objective (Nikon) at room temperature. 488 and 561 nm laser illumination was used for GFP/FM4-64 and mCherry excitation, respectively. Emission filters were 515/30 nm for GFP and 600/32 nm for mCherry/FM4-64. Image acquisition was controlled by MetaMorph software (Molecular Devices, Sunnyvale, CA).

34Images for each channel were acquired simultaneously on a Nikon A1R confocal microscope system with a 1.4 NA 100× oil immersion objective (Nikon) at room temperature. 488 and 561 nm laser illumination was used for GFP/FM4-64 and mCherry excitation, respectively. Emission filters were 525/50 nm for GFP and 595/50 for mCherry/FM4-64. Image acquisition was controlled by NIS-Elements software (Nikon).

35All images were processed using ImageJ software with enhanced contrast and background subtraction (rolling ball diameter of 50 was used for spinning disc images; for scanning confocal images a rolling ball diameter of 50 was used for actin filaments and 75 for all other labels). We also performed smoothing and applied the unsharp mask filter to all images. All settings were standard.