A Granulin-Like Growth Factor Secreted by the Carcinogenic Liver Fluke, Opisthorchis viverrini, Promotes Proliferation of Host Cells

1Cholangiocarcinoma (CCA), or cancer of the bile ducts, is prevalent in people from Thailand and Laos whose staple diet includes uncooked fish which harbour the liver fluke, Opisthorchis viverrini, the main risk factor for this cancer in the region. There is no stronger link between a parasite and cancer than that between O. viverrini and CCA - indeed WHO data suggest that as many as one-third of the nine million infected people will contract cancer. This is a striking figure compared to data from other carcinogenic microbes, such as Helicobacter pylori, human papilloma virus and the hepatitis viruses, where less than one percent of infected individuals develop infection-related cancers,.

2For opisthorchiasis, in vivo studies in hamsters and in vitro investigations have indicated that the fluke's excretory/secretory (ES) products, metabolic products excreted and secreted into the external environment from the excretory openings and epithelial surface (tegument), include mitogens that likely play a role in the initiation of CCA in infected humans and experimentally infected hamsters,. To gain a better understanding of the host-parasite interactions underlying the molecular pathogenesis of opisthorchiasis, we screened both the transcriptome and the ES proteome (J. Mulvenna et al., unpublished) of the fluke for genes encoding proteins with ontologies that were associated with human cancers. A homologue of human granulin, a secreted growth factor implicated in many aggressive and invasive cancers, was identified.

3The granulin domain consists of 12 highly conserved cysteines and is found in diverse phyla from eubacteria to humans, and subsequently has many synonyms. Compounding the confusion, the term granulin can also refer to the small 6–10 kDa granulin domain (also named epithelins or GEM∶granulin/epithelin modules) found in the majority of animals, or the vertebrate protein, progranulin (PGRN), which in mammals is a large 60–90 kDa glycoprotein containing seven tandemly repeated granulin motifs. PGRN protein is also known as PC cell-derived growth factor (PCDGF), proepithelin (PEPI), Granulin/epithelin precursor (GEP), GP88, acrogranin, granulin or epithelin precursor. Herein we will refer to the large multihomodomain form from vertebrates as PGRN, and granulin (GRN) will refer to the individual granulin domains.

4There is a broad distribution of PGRN in human organs and tissues, and elevated levels of mRNA are found in organs with neuronal cells (cerebellum), hematopoietic stem cells (spleen) and rapidly dividing epithelium (skin, gastrointestinal tract and wounded epithelia),. Numerous functions for GRNs have been reported but the roles in cell cycle control and wound healing are noteworthy. Numerous mutations have been observed within the human PGRN gene with many linked to psychiatric disorders including Alzheimer's disease and frontotemporal dementia,.

5Over-expression of PGRN is linked to tumorigenesis in numerous human tissues, including liver cancers, and is associated with an aggressive and invasive tumour phenotype,. GRN is a potent proliferative agent but has other pro-tumor qualities that are not yet well characterized. It may promote carcinoma progression by promoting angiogenesis, insensitivity to apoptosis, promotion of tumor invasion and anchorage independence which all support tumor expansion in the unfavorable interstitial environment,,. Preventing over-expression of PGRN in a range of tumor types, either through gene silencing or neutralizing antibodies, reduces or entirely inhibits tumor progression. Over-expression of PGRN is an indicator of poor prognosis for a range of cancer types, and anti-GRN antibodies have been successfully employed in mice as therapy for hepatocellularcarcinoma (HCC).

6Large-scale gene sequencing efforts have revealed GRN homologues in the majority of parasitic phyla,,. Like free-living eukaryotes, parasitic helminths probably utilize GRN to regulate growth and development of their own cells. By contrast, here we describe the detection of GRN in the ES products of O. viverrini and its binding to mammalian biliary epithelial cells in situ. Furthermore, recombinant O. viverrini GRN stimulated proliferation of fibroblasts, whereas antibodies against the recombinant GRN inhibited the ability of ES products to promote proliferation. Together these findings support a role for this fluke protein in establishment of a tumorigenic environment that may ultimately manifest as CCA.

7Characterization of the protein profile of O. viverrini adult worm ES products using LC-MS/MS revealed a 19 amino acid peptide, with a MOWSE score of 50 (delta error -0.0464) (Figure 1 inset), that matched to a single contig encoding a protein with sequence similarity to human granulin (not shown). The cDNA was termed Ov-grn-1 and its protein product Ov-GRN-1; the sequences were submitted to GenBank under accession number FJ436341. Verification of the MS/MS identification was then performed using multiple-reaction monitoring (MRM) transitions targeted against the peptide identified in the shotgun proteomics. Firstly, a tryptic digest of O. viverrini ES products, collected after one day of culture, was analyzed and the target peptide identified and fragmented. Next, recombinant Ov-GRN-1 in water was digested and analyzed in the same fashion. The target peptide from the ES sample was identified at the same elution time and with an identical product ion spectrum as that generated for recombinant Ov-GRN-1 (Figure 1). The peptide observed showed very abundant y-ion fragments, as expected, on the C-terminal side of the peptide. The peptide also revealed a missed trypsin cleavage at the Arg residue, due to the Pro residue on its C-terminal side. The combination of the initial MS/MS data, elution time of the target peptide in both samples and the similarity of MRM fragmentation patterns strongly supports the presence of Ov-GRN-1 in the ES products of O. viverrini.

8Ov-GRN-1, like homologues from the related liver fluke Clonorchis sinensis and earthworms, has an N-terminal signal peptide followed by a single GRN core domain. Most other proteins containing a GRN domain consist of multiple GRN domains (PGRN) or at least one GRN domain fused to other domains including proteases, protease inhibitors and fibronectin (Figure 2A). Ov-GRN-1 consists of a predicted secretion signal peptide followed by an 84 amino acid GRN domain of 9.04 kDa with twelve conserved cysteines. Whereas no N-linked glycosylation sites were predicted, four putative O-glycosylation sites were identified at Ser-26, Thr-35, Thr-41 and Ser-61. The core GRN domain of Ov-GRN-1 shared 43.6% identity at the amino acid level with granulin F, the closest human homologue, and 85% identity with an EST from the related liver fluke, Clonorchis sinensis (Figure 2B). Data from the few GRN structures available suggest that Ov-GRN-1 adopts the general GRN fold and disulphide bonding pattern akin to carp GRN, the only complete GRN structure available to date. The NMR derived structure of carp (Cyprinus carpio) granulin was used as the template on which to build a molecular model of Ov-GRN-1 (Figure 2C). The two proteins shared 32% identity over their granulin core domains. The lowest energy structure from 50 calculated using MODELLER was selected as an approximation of the structure of Ov-GRN-1. The model contained no violations of distance restraints and the Ramachandran plot, calculated with PRO-CHECK-NMR, showed a single residue in the disallowed regions.

9Ov-GRN-1 grouped very closely with its orthologue from the related liver fluke, C. sinensis, a parasite that has also been implicated as a cause of human CCA, and this clade obtained 100% bootstrap support (Figure 3). GRNs from the placozoan Trichoplax, slime mould, the free-living nematode Caenorhabditis elegans and human granulin B also formed a clade with the liver fluke GRNs, although this did not obtain bootstrap support of greater than 50%. Interestingly, the blood fluke (Schistosoma) GRNs did not group closely with Ov-GRN-1 – most O. viverrini genes share greater sequence identity with other platyhelminth genes than they do with genes from other phyla, suggesting that the phylogeny presented here reflects functional protein relationships rather than taxonomic relationships. It is also noteworthy that the schistosome GRN domains were probably derived from a multi-domain PGRN.

10Reverse transcription PCR using RNA from different Opisthorchis life cycle stages amplified a product of the expected size, ∼300 bp, in all developmental stages tested (Figure S1), indicating that Ov-grn-1 was constitutively expressed throughout the developmental cycle of the liver fluke. An amplicon was not detected in the absence of reverse transcriptase enzyme (not shown), confirming the absence of contaminating genomic DNA. The constitutively expressed actin gene served as a control and was expressed in all stages.

11Ov-GRN-1 was expressed in E. coli and in Sf9 insect cells. We herein refer to the E. coli-derived recombinant protein as Ov-GRN-1e and Sf9-derived protein as Ov-GRN-1s. Soluble 6×His tagged Ov-GRN-1s protein with a molecular mass of ∼14 kDa was expressed in Sf9 cells at a yield of ≤200 µg purified protein per litre of culture medium. A combination of cation exchange and Ni-NTA affinity chromatographies followed by a second Ni-NTA purification resulted in recombinant granulin that appeared to be greater than 95% pure based on SDS-PAGE gels (not shown). Ov-GRN-1e was highly expressed (up to 60 mg/L) in each of three E. coli cell lines (BL21, Rosetta, Rosetta-gami) but in each case the Ov-GRN-1e was insoluble and required urea (or other chaotropic agents) to solubilise. Different induction times and temperatures were assessed, and none of these variables promoted the solubility of the recombinant Ov-GRN-1e. To obtain denatured recombinant protein, BL21 E. coli cells transformed with pET41a encoding the Ov-GRN-1 ORF were grown at 37°C and induced for 16 h. Recombinant protein was purified on Ni-NTA resin under denaturing conditions to yield >95% pure protein (Figure 4A). Refolding of the purified denatured protein was undertaken, and the best conditions identified yielded ∼15% recovery of soluble protein by refolding in 20 mM Tris pH 7.5, 1 mM CaCl2 for 24 hr.

12IgG antibodies raised against recombinant Ov-GRN-1e and GRN-1s proteins in mice were employed to probe the recombinant immunogens and Opisthorchis somatic adult extract (SAE) by Western blotting under both native and denaturing/reducing conditions. Bands were only visible when SAE was probed under native conditions with both anti-GRN-1s and anti-GRN-1e IgGs, with a strong band visible at 38 kDa, higher than the predicted 9 kDa mass of the monomeric protein (Figure 4B). Neither antibody bound to any proteins under reducing/denaturing conditions (not shown), suggesting that conformational epitopes were the target of anti-GRN-1 antibodies, and that the native protein might form homo-multimers or form complexes with other proteins under native conditions. Control antibodies did not produce any bands under native or denaturing/reducing conditions. Anti-GRN-1s IgG was used to localize the sites of expression within adult O. viverrini and in the surrounding bile ducts of an experimentally infected hamster. Ov-GRN-1 exhibited ubiquitous expression through all tissues, particularly in the gut, tegument and tegument extrusions of the adult worm (Figure 4C, right upper panel). Interestingly, the protein was also strongly detected in the bile duct epithelial cells in close proximity to the liver fluke. Control mouse IgG did not bind to any tissue or structures in the fluke or hamster tissues (Figure 4C, left panel). Additionally anti-Ov-GRN-1s IgG showed no affinity for host granulin as indicated by a lack of staining in uninfected hamster liver (Figure 4C, lower right panel)

13Others have shown that O. viverrini causes proliferation of fibroblasts and the KKU-100 CCA cell line when these cells are co-cultured in the presence of live adult O. viverrini in a non-contact format,. We reproduced these findings (Figures 5A and S2A) and proceeded to show that soluble ES products from O. viverrini stimulated proliferation of NIH-3T3 fibroblasts (Figures 5B, S2B and S3) and the KKU-100 CCA line (not shown). Cell proliferation was measured using two distinct approaches. WST-1 is a measure of metabolic activity of cells, and although it is routinely used to measure cell growth over time, metabolic variations in cells exposed to different conditions (e.g. in the presence of ES products) can mask changes in real cell numbers. We also assessed the growth of cells using a real time index of measurement to corroborate the proliferation quantified by the WST-1 assay using an xCELLigence system. The cell index readout is a real time measure of conductivity which is indicative of cell surface area in contact with the gold electrodes covering the plate surface. We optimised the conditions for ES-induced cell growth to permit a thorough assessment of the effects of ES products (and other treatments) over time. Cells were seeded at an adequate density to determine growth over 3 days in a reliable manner before reaching confluence. Conditions that resulted in a minimum of two-fold growth of NIH-3T3 fibroblasts between samples treated with and without ES over 3 days were determined in the presence of increasing concentrations of bovine calf serum (BCS) in a 96 well plate – final conditions were 0% BCS seeded at 6000 cells/well, 2% BCS at 2000 cells/well, 5% BCS at 700 cells/well and 10% BCS at 300 cells/well. The optimal conditions identified for detection of approximately two-fold proliferation of NIH-3T3 fibroblasts induced by addition of ES compared with an equal volume of PBS (control) were as follows: 2,000 cells seeded per well and cultured for 3–8 h in DMEM containing antibiotic/antimycotic at 37°C in 95% air/5% CO2 and 2% BCS prior to addition of ES products (20 µl) to a final concentration of 20 µg/ml. Cells were cultured in the presence of ES or PBS and cell numbers were determined using the WST-1 dye procedure. Addition of ES to cells grown in all serum concentrations tested resulted in changes in cell growth and morphology; Figure 5C presents the results of cell growth in the presence of 2% BCS. The flattened fibroblastic shape of 3T3 cells changed upon addition of ES products, resulting in a longer, narrower and more refractive spindle shaped cell morphology.

14A range of concentrations of recombinant Ov-GRN-1e was included with cells under different culturing conditions, based on information from other investigations with ES, as described above. Nanomolar concentrations (50–200 nM) of Ov-GRN-1e induced significant growth of cells above growth of control cells treated with either PBS or an irrelevant recombinant protein purified under the same conditions as for Ov-GRN-1e (Figures 6 and S4). Four hundred nM Ov-GRN-1e induced significant growth after one day (P<0.05), after which cell growth slowed and cell numbers were equivalent to cells treated with control protein by day 3 (Figure 6A). At higher concentrations (≥800 nM) the cells suffered adverse effects and did not survive beyond 24 hr (not shown). Compared to control protein, 200 nM Ov-GRN-1e promoted significant growth after one day (P<0.05) and 50–200 nM Ov-GRN-1e caused significant growth by day 3 (P<0.05; Figure 6B). Cell proliferation induced by both ES products and recombinant Ov-GRN-1 was completely ablated in the presence of 10 µM U0126, an inhibitor of Erk1/2 signalling, indicating that Ov-GRN-1, like human PGRN, signals via the MAPK pathway.

15Intriguingly, refolded Ov-GRN-1e that was concentrated (retentate) using a 3 kDa cut-off centrifugal concentrator membrane did not induce cell growth, however the column flow through (i.e. >3 kDa) did induce proliferation. Indeed, the proliferation was greatly enhanced at lower concentrations (10 nM) compared with refolded Ov-GRN-1e that had not undergone concentration (50–200 nM; measured in real time by xCELLigence - Figures 7 and S5). Using both SDS PAGE and Western blotting with anti-6×His antibody we identified a small amount (∼5–10% of purified and refolded protein) of refolded protein that reproducibly passed through a 3 kDa cut-off membrane.

16To determine whether Ov-GRN-1 was responsible for the mitogenic activity of ES, we attempted to neutralize the mitogenic activity of ES with anti-Ov-GRN-1 antibodies. Anti-GRN-1s IgG inhibited ES-induced proliferation of NIH-3T3 fibroblasts (Figures 8A and S6A). After 3 days of cell culture, significant inhibition of proliferation was evident at concentrations of 20 and 40 µg/ml IgG in both 2% and 5% BCS cultures (P<0.01 - <0.001). Similar antibody-induced suppression of proliferation was obtained in the absence of BCS over two days (not shown), but after two days control cells (treated with PBS) began to die.

17NIH-3T3 cells were grown under identical conditions as described above −20 µg/ml ES, 20 µg/ml test or control IgGs and 2% BCS over 3 days - and monitored with the xCELLigence system (Figures 8B and S6B). Cells treated with ES alone or ES in the presence of control IgG grew at the same rate (F(2,186) P = 0.65) with a steady increase of 0.2–0.25 units over 24 hours and then a reduced rate of increase of 0.05–0.1 units for the subsequent two days. This was similar to the growth rates measured with WST-1. When ES in the presence of either anti-Ov-GRN-1e or anti-Ov-GRN-1s IgGs were incubated with cells, growth slowed significantly (F(2,186) P<0.0001) compared to cells treated with ES alone or ES plus control IgG and showed only minor variations from the growth profile of NIH-3T3 cells treated with PBS alone (Figure 8B).

18The inhibitory effect of anti-Ov-GRN-1 IgG on the growth of the KKU100 CCA cell line induced by ES products was also assessed. Cells were cultured for 3 days in RPMI 1640/2% BCS with a final concentration of 20 µg/ml ES. Cell growth is presented as absorbance at 450 nm rather than as a growth ratio because of the differences in growth characteristics between this cell line and NIH-3T3 fibroblasts. The same general trend was observed, whereby anti-GRN-1e and to a lesser but still significant extent, anti-GRN-1s, IgGs inhibited proliferation induced by ES in an antibody dose-dependent fashion (Figure 8C). Significant inhibition was observed with 16 µg/ml (P<0.05) and 24 µg/ml (P<0.001) anti-GRN-1e IgG. Addition of IgGs to cells in the absence of ES had no effect on cell growth (not shown).

19Initiation of CCA in chronic opisthorchiasis in humans and experimentally infected hamsters is thought to be multi-factorial, involving (1) infection-induced inflammation, particularly the release of reactive oxygen and nitrogen species from inflammatory cells, (2) dietary nitrosamines consumed by endemic populations, (3) secretion by the fluke of mitogens into the biliary tree. Co-culture of O. viverrini adult worms with mouse fibroblasts (NIH-3T3) where parasites and cells are separated by a porous membrane results in cell proliferation. Here we show that soluble ES products, in the absence of live O. viverrini parasites, and recombinant Ov-GRN-1e cause proliferation of mouse fibroblasts and a human CCA cell line, and that proliferation caused by ES products can be blocked with anti- Ov-GRN-1e antibodies. This data implies that Ov-GRN-1 is perhaps the major mitogenic factor in ES, and this protein contributes to the development of an environment that is conducive to CCA.

20The GRN protein family is found in a diverse range of organisms including bacteria, plants and animals. Our phylogenetic analysis of the protein family suggested that a majority of GRN proteins do not form clades based on taxonomic groupings but rather group according to protein functions. The individual GRN domains from human PGRN form distinct clades with homologues from other species, supporting the notion that these proteins have evolved to perform distinct functions in different organisms, and furthermore, individual GRN domains released after processing of the multi-domain PGRN have also evolved to perform discrete functions. A range of organisational archetypes are seen within the family, ranging from single GRN domains behind a secretory signal peptide, as seen in earthworms and the liver flukes, to multi-homodomain PGRNs and even single GRN domains fused to other protein domains.

21The structure of GRN is unique, although it can be partially superimposed on the 3-dimensional fold of epidermal growth factor (EGF), despite the absence of primary sequence identity. Furthermore, Ov-GRN-1 and human PGRN, like EGF, triggers similar signalling cascades, including the MAPK pathway. When NIH-3T3 fibroblasts were co-cultured with O. viverrini adult worms without serum, only mRNAs associated with EGF and TGF-beta signalling pathways were significantly upregulated, further supporting a role for Ov-GRN-1 in parasite-induced proliferation and downstream signalling of host cells. Granulin-induced cell proliferation can result in upregulation of EGF family members, such as VEGF, which could account for upregulation of genes involved in the EGF pathway.

22Ov-GRN-1 was expressed at very low levels in lepidopteran (Sf9) cells, limiting more thorough investigation of this form of the protein. By contrast, Ov-GRN-1 was expressed at high yield in E. coli and could be refolded into an active form that induced proliferation at nanomolar concentrations. This is the first report, to our knowledge, of a secreted growth factor from a parasite that induces proliferation of host cells. This is also the first report of functional recombinant expression of a single domain granulin. Tolkatchev expressed all 7 granulin domains individually from human PGRN but only three, granulins A, C and F, appeared to adopt at least partially correct fold and induced growth. Despite refolding denatured Ov-GRN-1e to generate a functional recombinant protein that induced cell proliferation, the majority of functional recombinant protein passed through a 3 kDa cut-off membrane. If Ov-GRN-1 does indeed adopt a similar fold to carp granulin (Figure 2C), the super helical structure held tightly together by 6 disulphide bonds might well pass through a 3 kDa membrane (Figure 7). Furthermore, the apparent molecular weights of native human granulins purified from leukocytes range from 1.7–3.2 kDa and would likely pass through a 3 kDa membrane, as we observed here with functionally active Ov-GRN-1. The low nanomolar activity displayed by refolded Ov-GRN-1 is comparable to the activity of purified human granulins.

23GRN is associated with many aggressive cancers. It is over-expressed in human liver,, renal, breast,,, bladder and brain tumors. It may promote cancer progression by stimulating angiogenesis, suppressing anoikis (a form of apoptosis), promotion of tumor invasion and anchorage independence, all of which support tumor expansion in the unfavourable interstitial environment,,. Preventing the activity of PGRN in a range of tumor types, either through gene silencing or antibody neutralization, reduces or entirely inhibits tumor progression. Transfection of fibroblasts with PGRN induces serum independent proliferation but does not transform them into neoplastic cells, suggesting that the protein is probably not oncogenic by itself, but over-expression of PGRN in the SW-13 non-malignant adrenal carcinoma cell line made it highly tumorigenic. Indeed, PGRN is a therapeutic target for liver cancer, particularly HCC. An anti-PGRN monoclonal antibody inhibited tumor growth in vivo in nude mice transplanted with human HCC. The anti-PGRN antibody also inhibited growth of hepatoma cells but had no significant effect on normal liver cells, and inhibited the growth and proliferation of established tumors via the p44/42 MAPK and Akt pathways. These findings demonstrate that GRN is an important factor in the initiation of liver cancer and the migration of cancerous cells. We showed here that Ov-GRN-1 signals via the MAPK pathway, further accentuating the potential role of this parasite protein in the initiation of CCA in people with chronic opisthorchiasis.

24Increased PGRN expression has not been reported in CCA, however, when gene expression profiles from intrahepatic CCA associated with or without O. viverrini were compared, genes associated with growth factor signalling were the most highly upregulated ontology in the non-fluke associated CCA, whereas genes involved in xenobiotic metabolism were the most highly upregulated genes in fluke associated CCA. It is intriguing that genes involved in growth factor signalling pathways were selectively upregulated in non-fluke associated CCA. This prompts the speculation that Ov-GRN-1 causes excessive proliferation and migration of pre-cancerous and cancerous cells in the bile ducts of infected people, obviating the necessity for local upregulation of the host growth factors and associated signalling molecules during tumorigenesis.

25Why O. viverrini secretes such a potent growth factor that acts on host cells is unclear. One potential role for fluke GRN is in the wound repair. Inflammatory cells secrete peptides derived from PGRN, and PGRN mRNA is highly induced in dermal fibroblasts and epithelial cells following transcutaneous puncture wounds. Furthermore, recombinant PGRN increased the accumulation of inflammatory cells, blood vessels and fibroblasts at puncture sites, implying a direct role as a wound-healing growth factor. O. viverrini adult worms grasp the bile duct wall with their suckers and feed on the biliary cells, often severely damaging the epithelium. Additional inflammation occurs as a result of the local immune response to resident worms (reviewed in ). Ov-GRN-1 might therefore play a role in wound repair at and around the feeding site to minimize the pathology that the parasite causes to the host. Another potential role for Ov-GRN-1 is in the “farming” of host cells for nutritional purposes. By promoting growth of cells at the feeding site, the parasite is ensured of a steady supply of nutrients. Blood-feeding leeches secrete a GRN that inhibits thrombin activity, and Ov-GRN-1 might also perform a similar function to interfere with clot formation while feeding.

26Like some other O. viverrini proteins, Ov-GRN-1 was identified on the surface of and inside host biliary epithelial cells. O. viverrini ES products adhere to and are internalised by hamster biliary epithelial cells in the first order bile ducts as well as the small extra-hepatic bile ducts where the parasite is too large to reside. Until now, only one ES product that is internalized by host cells had been identified - thioredoxin peroxidase. The mechanism of uptake of O. viverrini ES components by host cells is unknown. With a related fluke, Schistosoma japonicum, fluke glutathione transferase (GST) is translocated from the medium into a variety of mammalian cell types via an endocytotic pathway involving clathrin-coated pits. Like most helminth parasites, O. viverrini secretes a GST (J. Mulvenna et al., unpublished), which along with other ES proteins (such as Ov-GRN-1), might enter host cells via a similar endocytotic mechanism. Translocation of O. viverrini proteins into host biliary epithelial cells is particularly important due to the carcinogenic nature of this parasite and the putative roles that internalised ES play in transforming host cells. Helicobacter pylori delivers the CagA protein into gastric epithelial cells where it interacts with a kinase involved in cell polarity, resulting in disorganization of gastric epithelial architecture, inflammation and carcinogenesis. Translocation of O. viverrini ES products such as Ov-GRN-1, into biliary epithelial cells might likewise interfere with signalling, promoting carcinogenesis. Moreover, liver fluke ES products inhibit apoptosis (B. Sripa, unpublished; ), further contributing to a tumorigenic environment.

27Despite the deployment of mass drug administration programs throughout Thailand, opisthorchiasis is still a major public health concern, and the prevalence of the infection in some areas is increasing,. Like other neglected tropical diseases, an integrated control program is required to have a lasting impact on reducing transmission and disease burden. To this end, a vaccine for opisthorchiasis is desperately needed to reduce worm burdens and minimize pathology. A recombinant vaccine based on Ov-GRN-1 is particularly attractive because of the potential role of this protein in establishing a pro-tumorigenic environment in the bile ducts. Such a vaccine would therefore have a major impact on reducing both parasite burdens and the incidence of CCA, the most prevalent and fatal of the liver cancers in north-east Thailand.

28Hamsters used in this study were maintained at the animal research facility of the Khon Kaen University Faculty of Medicine; all work was conducted in accordance with protocols approved by the Khon Kaen University Animal Ethics Committee. Mice used in this study were housed at the Queensland Institute of Medical Research (QIMR) animal facility; all work was conducted in accordance with protocols approved by the QIMR Animal Ethics Committee.

29O. viverrini metacercariae were obtained from naturally infected cyprinoid fish in Khon Kaen province, Thailand. The fish were digested with pepsin-HCl, washed and used to infect hamsters (Mesocricetus auratus) by stomach intubation. Adult O. viverrini worms were recovered from bile ducts of euthanized hamsters infected for 3 months. Somatic adult worm extract (SAE) was prepared from frozen and homogenized adult worms resuspended in PBS with a cocktail of protease inhibitors covering serine, aspartic, cysteine and metallo-proteases (protease inhibitor cocktail set #5, Roche). ES products were prepared from live adult worms washed in antibiotics and incubated in modified RPMI-1640 (Invitrogen) at 37°C/5% CO2. Supernatant containing the ES products was harvested daily for 7 days. The supernatant was concentrated 20-fold to 100–300 µg/ml with 3 kDa Jumbosep spin concentrators (Pall) and aliquoted for storage at −80°C.

30Ov-GRN-1 was identified in the ES products of adult O. viverrini using liquid chromatography tandem mass spectrometry (LC-MS/MS). The proteins present in ES products were identified by trypsin digestion followed by a combination of off-gel electrophoresis and LC-MS/MS as described by us for the analysis of ES products from the hookworm, Ancylostoma caninum. For multiple reaction monitoring (MRM), recombinant Ov-GRN-1 in water and O. viverrini ES were digested as described. A Dionex 3000 HPLC system (Dionex) was used to perform reversed phase separation of the samples using a C18 300A column (150 mm×2 mm) with a particle size of 5 µm (Phenomenex). Twenty microliter aliquots of samples were dissolved in 5% formic acid (aq) and injected onto the HPLC column. The mobile phase consisted of solvent A (0.1% formic acid (aq)) and solvent B (90/10 acetonitrile/0.1% formic acid (aq)). Tryptic peptides were eluted using a gradient elution programme of 0–40% B in 40 min, 40–80% B in 10 min and finally a 5-min hold at 80% B, followed by a return to 0% B for a 10-min equilibration. The flow rate was 250 µl/min. Eluate from the RP-HPLC column was directly introduced into the TurboIonSpray source. Mass spectrometry experiments were performed on a hybrid quadrupole/linear ion trap 4000 QTRAP MS/MS system (Applied Biosystems). All analyses were performed using MRM, Information Dependant Acquisition Initiation Enhanced Product Ion experiments using both the triple quadrupole and the linear ion trap acquisition modes. Analyst 1.5.1 software was used for data analysis. The acquisition protocol to provide mass spectral data for both identification and characterization involved monitoring the HPLC eluant using MRM scans; ions over the background threshold of 200 counts per second were subjected to examination using the enhanced resolution scan to confirm charge states of the multiply charged molecular ions. The most and next most abundant ions in each of these scans with a charge state of +2 to +4 or with unknown charge were subjected to collision induced disassociation using a rolling collision energy dependent upon the m/z and the charge state of the ion. An enhanced product ion scan was then used to acquire the product ion spectrum. The 4000 QTRAP equipped with a TurboIonSpray Source was operated in the positive electrospray ionization mode.

31Sequences were edited and analysed with assistance from the MacVector software package. Homology searches were performed using Blast search at NCBI (http://blast.ncbi.nlm.nih.gov/Blast.cgi). ORFs were analysed for signal peptides/anchors using SignalP-NN prediction and SignalP-HMM prediction at http://www.cbs.dtu.dk/services/SignalP/. The O. viverrini cDNA encoding for GRN was termed Ov-grn-1 and was submitted to GenBank under accession number FJ436341. The structural architecture of GRN family members was obtained from entry IPR000118 at the Interpro 18.0 database. Prediction of potential glycosylation sites was determined using the YingOYang server.

32Using version 3 of MODELLER, the three-dimensional structure of Ov-GRN-1 was predicted based on comparative modelling to carp granulin. The covalent geometry of the modelled structure was in agreement with the template structures with all but one of the residues occupying the allowed regions of the Ramachandran plot. The quality of the stereo-chemical structures of the models was determined using PRO-CHECK-NMR. Pymol was used to view the homology models (http://www.pymol.org)

33The phylogenetic relationship of Ov-GRN-1 with other GRN family members was inferred using a neighbor joining analysis in PAUP beta version 8.0 for Macintosh. Bootstrap values were determined from 1000 replicates. Where bootstrap values were below 50%, clades were collapsed to form polytomies. Where multiple GRN domains were observed within one PGRN protein (e.g., vertebrates and schistosomes), individual GRN domains sharing the greatest identity with Ov-GRN-1 were selected and numbered 1–3 in order of their identities. The individual GRN domains of human PGRN, however, have been alphabetically designated A–G in the order GFABCDE, based on their description in the literature.

34Extraction of O. viverrini RNA and subsequent reverse transcription PCR (RT-PCR) was carried out as described, with minor modifications. Total RNA from each developmental stage of O. viverrini was extracted with Trizol (Invitrogen) according to the manufacturer's instructions. Contaminating genomic DNA was removed by treatment of RNA with DNase I (Promega). For RT-PCR, first-strand cDNA was synthesized from 1.0 ug of total RNA using avian myeloblastosis virus reverse transcriptase (Promega) and an oligo (dT) primer at 42°C for 60 min. A 1.0 µl aliquot of the cDNA was amplified using primers specific for the control beta-actin mRNA (Forward CGAGGTATCCTCACCCTCAA, Reverse GCGACTCGCAACTCATTGTA) and the target Ov-grn-1 mRNA (Forward CGCGCGCCATGGATACTTTGCAGCCAATT, Reverse GCGCGCCTCGAGTGCGACCTTTCGAGCGTT) based on the following conditions: 30 sec denaturation at 94°C, 30 sec annealing at 55°C, and 30 sec extension at 72°C for 30 cycles. Control RT-PCR reactions were performed without reverse transcriptase to ensure that amplified products were derived from cDNA and not contaminating genomic DNA. PCR products were sized by electrophoresis through 1% agarose and visualized under UV light after staining with ethidium bromide.

35Ov-GRN-1 was expressed in both bacterial and insect cell expression systems. The complete ORF minus the predicted signal sequence was amplified using Expand polymerase (Roche) from an adult O. viverrini cDNA library using primers described below and cloned into the plasmid pMIB/V5-His (Invitrogen) for insect (Spodoptera frugiperda) cell expression or cloned into the NdeI and XhoI sites of the pET41a vector (Novagen) for E. coli expression, thereby removing the GST fusion tag but retaining the 6×His tag and allowing for native N-terminal protein expression. Primers for insect cell expression were: pMIB F3 HindIII CGCGCGAAGCTTAATGGATACTTTGCAGCCAATT; pMIB R3 XbaI GCGCGCTCTAGATGCGACCTTTCGAGCGTT. Plasmid preparation, cell transfection, colony selection and growth of Sf9 cells (Invitrogen) was as previously described. Primers for E. coli expression were: pet41 NcoI F7 CGCGCGCCATGGATACTTTGCAGCCAATT; pet41 XhoI R7 GCGCGCCTCGAGTGCGACCTTTCGAGCGTT. Plasmids were prepared using standard techniques and used to transform E. coli cell lines (BL21, rosetta, rosetta-gami cells – Novagen) followed by selection with kanamycin and other appropriate antibiotics according to the manufacturer's instructions. Cells were grown in LB medium at temperatures between 16–37°C in 1 L Schott bottles at 220 rpm. Cultures were induced with 1 mM IPTG upon reaching an OD600 of 0.5 and grown overnight before harvesting the cell pellet.

36Since both recombinant proteins (derived from E. coli and Sf9 insect cells) contained C-terminal 6×His tags, the purification procedures included immobilized metal ion affinity chromatography (IMAC). Purification was undertaken using an AKTA basic purification system (GE) at 4°C. Henceforth we refer to the E. coli-derived recombinant protein as Ov-GRN-1e and Sf9-derived protein as Ov-GRN-1s. For Ov-GRN-1s, 3 L of culture supernatant was passed across a 5 ml Hitrap HS HP cation exchange column (GE) with a gradient of 0–1 M NaCl over 10 column volumes. Fractions enriched for recombinant protein were detected using an anti-V5 affinity tag antibody (Invitrogen). Further purification of these fractions was achieved by a subsequent IMAC step; protein was bound to 1 ml Ni-NTA resin (Qiagen) in 10 mM imidazole/sodium phosphate (pH 8) and washed with 10 column volumes of 20, 40 and 60 mM imidazole, followed by elution in 250 mM imidazole. Fractions containing recombinant protein were subjected to a second round of IMAC as above, followed by concentration to 1 mg/ml and buffer exchange into PBS using 3 kDa microsep spin columns (Pall). For purification of Ov-GRN-1e, 3 g of E. coli cell pellet was resuspended in 30 ml binding buffer (50 mM Tris-HCl, 300 mM NaCl, 0.1% Triton X-100) followed by three disruption cycles through a chilled French press at 16–18000 psi. The sample was centrifuged at 4000 g and the pellet was dissolved in 6 M urea in nickel (Ni)-NTA binding buffer with 40 mM imidazole overnight at 4°C with gentle mixing. The supernatant was collected by centrifugation as above and purified by denaturing IMAC, with 6 M urea in all buffers, over a 5 ml His-trap Ni-IDA column (GE). The column was washed with 100 mM imidazole and recombinant protein eluted with 500 mM imidazole/6 M urea. The eluate was concentrated to 20 mg/ml using 3 kDa 15 ml Amicon Ultra centrifuge concentration devices (Millipore) and refolded by drop wise addition to a 20-fold greater volume of a range of refolding buffers. The soluble material was buffer-exchanged into PBS using a PD10 column (GE).

37Ov-GRN-1e and GRN-1s were adjusted to 0.4 mg/ml and diluted 1∶1 with Freund's adjuvant and emulsified. Twenty micrograms of protein (100 µl of protein∶adjuvant) was injected subcutaneously into each of four BALB/c female mice every two weeks, using Freund's complete adjuvant for the first immunization and Freund's incomplete adjuvant for the second and third immunizations. Two weeks after the final immunization, mice were euthanized, blood collected by cardiac puncture, and sera recovered from the clotted blood. Control sera were obtained from mice that were either (1) unimmunized or (2) immunized with an irrelevant control protein (recombinant Na-GST-1 glutathione-S-transferase from Necator americanus). Sera were pooled and diluted 1∶20 with PBS for affinity purification of IgG on Hitrap protein G (GE) at 4°C using an AKTA basic FPLC. Eluted fractions were concentrated with 30 kDa nanosep spin concentrators (Pall), buffer exchanged into PBS and stored at −80°C.

38Denaturing and native polyacrylamide gel electrophoresis (PAGE) was performed using 15% gels. Proteins were electro-transferred to Biotrace nitrocellulose membranes (Pall), which were then sliced into 3 mm wide strips. Membranes were blocked in 5% skimmed milk powder (SMP)/PBS with 0.05% Tween 20 (PBST) for 60 min at room temperature (RT) with gentle shaking and probed overnight with 8 µg/ml mouse IgG diluted in 2% SMP/PBST at 4°C. Subsequently, membranes were washed (3×10 min each) in PBST at RT followed by probing with horse radish peroxidase (HRP)-conjugated goat anti-mouse IgG (Zymed Laboratories) diluted 1∶300 in 2% SMP/PBST at RT with gentle rocking for 60 min. After washing to remove the secondary antibody, colorimetric signals were developed in the presence of hydrogen peroxide and diaminobenzidine (DAB) (Pierce).

39O. viverrini adult worms or liver tissue from hamsters infected with O. viverrini (weeks 12–16 weeks) were fixed and cut by microtome into sections of 4 µm. The sections were deparaffinised in xylene, hydrated in a series of ethanol and distilled water, respectively. Endogenous peroxidise was eliminated by incubating sectioned tissues in 5% H2O2 in methanol for 30 min, after which the sections were rehydrated in water and PBS. Non-specific staining was blocked by incubation in 5% normal mouse serum in PBS for 30 min. The sections were probed with pooled mouse purified IgG diluted 1∶100–1∶500 (v/v) in PBS and incubated overnight at 4°C. After rinsing 3×5 min with PBS the sections were incubated with horseradish peroxidase-conjugated goat anti-mouse IgG (Zymed Laboratories) for 1 h. Sections were rinsed with PBS 2×10 min, after which the slides were developed with DAB. The sections were counterstained with Mayer's haematoxylin, dehydrated, cleared in xylene and mounted in Permount® (Cen-Med). The sections were examined by light microscopy and images captured with a digital camera.

40ES products, recombinant proteins and IgG antibodies that were included in cell culture were filtered under sterile conditions with 0.22 µM syringe filters (Pall). Dilutions were carried out in sterile PBS in Twintec 96 well plates (Eppendorf). Samples were prepared so that 20 µl of ES protein or antibody in sterile PBS was added to 100 µl of cell culture media. Protein concentrations described hereafter refer to the final concentration in cell culture after dilution in media. All assays were conducted either in triplicate or duplicate, as specified in figure legends. Controls were relevant for the sample tested: expression matched recombinant proteins were included to assess effects of recombinant granulin – a hookworm protein, Na-ASP-2, expressed in insect cells served as the control protein for Ov-GRN-1s; Sm-TSP-2 EC2 expressed in E. coli served as the control protein for Ov-GRN-1e. Antibodies against recombinant proteins for use in cell culture were purified as above. The Erk1/2 (MAPK) kinase inhibitor, U0126 (Cell Signalling Technology) was used at a final concentration of 10 µM in some cell cultures to assess its ability to block signalling induced by ES products or recombinant Ov-GRN-1.

41NIH 3T3 mouse embryonic fibroblast cells (ATCC) were maintained as specified by ATCC protocols. Briefly, cells were maintained with regular splitting using 0.25% trypsin every 2–5 days in DMEM (Sigma) with 10% bovine calf serum (BCS) and 1×antibiotic/antimycotic (Invitrogen) at 37°C under 5% CO2. To assess the effects of ES on cell growth, multiple culture conditions were investigated in 96 well plates including seed densities (1,000–10,000 cells/well), cell attachment times before sample addition (3 h, 6 h, 16 h), BCS concentration (0, 2, 5 and 10%), ES concentration (10–80 µg/ml) and duration of culture after sample addition (1–3 days). The ability of live O. viverrini flukes to stimulate cell proliferation was assessed using a non-contact co-culture technique as described. KKU-100 is a cell line derived from a human CCA and was maintained as described. Cell proliferation was determined using two different approaches. First, cell numbers were assayed using the WST-1 cell proliferation reagent (Roche) as per product manual. Briefly the procedure involves incubating the cells with 10 ul of WST-1 for up to four hours at 37°C. During this period viable cells, which contain mitochondrial dehydrogenases, convert WST-1 to a water soluble formazan dye which has a peak absorbance at 450 nm which is measured on a Benchmark Plus plate reader (BioRad) and data were converted into cell numbers per well via comparison to standard curves.

42Cell proliferation was also assessed by counting cell numbers in real time using a xCELLigence system and E plates (Roche) which monitors cellular events in real time by measuring electrical impedance across interdigitated gold micro-electrodes integrated on the bottom of tissue culture plates. The impedance measurement provides quantitative information about the biological status of the cells, including cell number, viability, and morphology. Cell culture conditions tested were the same as those tested with the WST-1 dye (2% BCS, 20 µg/ml ES, 20 µg/ml IgG).