Wolbachia-Mediated Cytoplasmic Incompatibility Is Associated with Impaired Histone Deposition in the Male Pronucleus

1Wolbachia are intracellular bacteria that infect some 65% of all insect species. Their success is in large part due to their efficient maternal transmission and their ability to alter host reproduction such that infected females produce more offspring than uninfected females. The most common form of altered reproduction is known as cytoplasmic incompatibility (CI), a form of conditional sterility resulting from crosses of Wolbachia-infected males to uninfected females. These crosses produce defects in the first zygotic mitosis resulting in inviable embryos. Significantly, if both the female and the male are infected, no defects are observed and viable embryos are produced. This phenomenon is known as Rescue. Consequently in Wolbachia-infected populations, infected females produce viable progeny whether they mate to infected or uninfected males. In contrast, uninfected females produce viable progeny only when mated to uninfected males. Thus infected females enjoy a tremendous selective advantage over uninfected females resulting in the rapid spread of Wolbachia via the maternal lineage. The success of this strategy is underscored by the fact that CI has been documented in every insect order.

2CI crosses produce embryos in which the paternal chromosomes are improperly condensed when aligned at the metaphase plate of the first mitotic division following fertilization –. It should be noted that the first mitotic division is unique in many insects, including Drosophila, because the paternal and maternal chromosomes reside on separate regions of the metaphase plate and are independently regulated with respect to entry into anaphase,. As the embryo progresses into anaphase, paternal sister chromatids either fail to segregate, or exhibit extensive bridging and fragmentation during segregation, a hallmark of damaged or incompletely replicated chromosomes. It is thought that strong CI elicits chromosome condensation defects severe enough to activate the spindle assembly checkpoint and prevent segregation while weak CI results in more mild defects in which the checkpoint fails to activate, allowing improper segregation. Defects earlier in the cell cycle at the prophase/metaphase transition have also been reported. These include a delay in Cdk1 activation and nuclear envelope breakdown in the male pronucleus relative to the female pronucleus.

3These observations leave unresolved the cause and effect relationship between the chromosome condensation and Cdk1 activation defects in CI embryos. It is well established that defects in DNA replication and chromosome condensation lead to cell cycle checkpoint induced delays in Cdk1 activation. However Cdk1 activation is required to drive chromosome condensation and failed Cdk1 activation results in failed chromosome condensation. To identify the proximal defects in CI embryos, we sought to determine whether CI-induced chromatin defects occur prior to Cdk1 activation during the interphase/prophase transition. Identification of earlier chromatin defects, during the sperm to male pronucleus transformation, would strongly argue that these are proximal to and the cause of the delayed Cdk1 activation and chromosome condensation/segregation defects observed during prophase and metaphase.

4Based on this reasoning, the work presented here focuses on sperm formation and sperm transformation into the male pronucleus in normal and CI crosses. To facilitate a compact configuration, the sperm chromatin is packaged with specialized small basic proteins known as protamines. Another unique property of the Drosophila sperm is that the nuclear envelope lacks lamins and nuclear pores. Immediately following fertilization, the nuclear envelope, the plasma membrane and the protamines are removed, and de novo nucleosome assembly is initiated using maternally supplied core histones. This nucleosome assembly occurs prior to DNA replication, and is executed by a replication-independent pathway that uses histone variant H3.3 and its specific chaperone HIRA. In addition, the formation of the male pronucleus requires the ATP-dependent chromatin remodeling enzyme CHD1. After these remodeling events, the nucleus acquires a conventional nuclear envelope containing lamins and nuclear pores. As the egg completes meiosis, the newly formed male and female pronuclei initiate DNA replication while migrating towards one another. Once the replication is complete, Cdk1 activation triggers mitotic entry in the closely apposed pronuclei.

5The studies presented here demonstrate CI- specific defects in H3.3/H4 deposition and prolonged retention of PCNA in the male pronucleus. These results suggests that in CI crosses, the male pronucleus enters mitosis with improperly condensed chromatin and incompletely replicated DNA. Significantly remodeling of the sperm chromatin including protamine removal and H3.3/H4 deposition occurs during interphase, well before Cdk1 activation and entry into mitosis. Thus our results suggest a model in which the initial defects in chromatin assembly in the male pronucleus activate cell cycle checkpoints delaying Cdk1 activation and mitotic entry. These chromatin remodeling defects also explain previous findings of defects during metaphase and anaphase in chromatin condensation and segregation. Because H3.3 deposition plays a key role in the transcriptional regulation throughout development, our results may provide insight into other effects Wolbachia has on its host.

6To confirm that the CI-induced segregation and condensation defects are limited to the paternal chromosomes, we used an antibody directed against acetylated histone H4 that preferentially labels the de novo assembled paternal chromatin after protamine removal in Drosophila eggs (Figure 1, ). We used D. simulans rather than D. melanogaster, since CI is very robust in the former species only. In CI embryos, the maternal chromosomes segregate normally at anaphase while the paternal chromosomes lag on the metaphase plate. At late telophase, bridges are observed between separating paternal sister chromosome complements (Figure 1, ). This results in severe nuclear division failures and accounts for the pre-cellular embryonic lethality in CI crosses. In stronger CI cases, severe disruption of paternal chromosome segregation results in their exclusion from both daughter nuclei. In haplo-diplo species this pattern of segregation produces viable haploid males. The detection of acetylated histone H4 also demonstrates that sperm chromatin remodeling is initiated in CI crosses and this led us to examine protamine removal and histone deposition during this period.

7During spermatogenesis in many higher eukaryotes, including Drosophila, core histones in the sperm nuclei are replaced by protamines, sperm-specific chromosomal proteins that allow a greater chromatin compaction. To assay protamine deposition and removal in CI embryos, we created a transgenic D. simulans stock expressing D. simulans protamine fused to GFP under the control of its endogenous promoter. In non-infected and infected testis, the fusion protein was incorporated into spermatids and present in mature sperm in seminal vesicles. (Figure 2A, 2B, and 2C). In both, control and CI fertilized embryos, Protamine-GFP was removed immediately after sperm entry, before completion of the female meiotic division (Figure 2, n = 22 for CI (D–H), n>20 for control (J)). To verify that Protamine-GFP can be visualized in early D. simulans embryos, we took advantage of rare double fertilization events (Figure 2I, asterisk). In this case Protamine-GFP was visible in the additional, non-activated sperm DNA while absent from the male chromosomes lagging on the metaphase plate (arrow). Thus, at the cytological level, no obvious differences in protamine removal and deposition are observed in CI embryos.

8Immediately following the removal of protamines from the male pronucleus, paternal nucleosomes are assembled using maternally supplied histones. This replication-independent nucleosome assembly specifically involves the H3.3 histone variant, which is deposited along with H4, followed by H2A and H2B. H3.3 is thus specifically deposited in the male pronucleus before the completion of the female meiosis and remains enriched in paternal chromosomes throughout the first mitotic division. The paternal chromosomes lose H3.3 by incorporation of canonical histone H3 with each new round of replication.

9In order to take advantage of both the strong CI of D. simulans and of transgenic markers only available in D. melanogaster, we performed hybrid crosses between D. simulans males and D. melanogaster females. Previous studies demonstrated that this hybrid cross exhibits a robust CI and Rescue and is an appropriate system for studying CI. Infected or non-infected D. simulans males were crossed with non-infected transgenic D. melanogaster females expressing a tagged H3.3-FLAG histone (CI and control crosses, respectively). In all embryos examined from the above control hybrid cross (n = 51), a robust H3.3 deposition was observed in the male pronucleus prior to completion of female meiosis, similar to the H3.3 deposition observed in single species D. melanogaster control crosses (not shown). All exhibited normal H3.3 deposition in the male pronucleus before the completion of female meiosis (n = 30, Figure 3A). However in hybrid CI crosses, 22% of the embryos exhibited an abnormal H3.3 accumulation at the periphery of the male pronucleus before the completion of female meiosis (n = 63, Figure 3A). In all nuclei with an abnormal accumulation at the periphery, no H3.3 staining was observed inside the nucleus suggesting a failure or an altered pattern of early H3.3 deposition. No lamin is detected at this stage (Figure S1), which suggests that nucleosome assembly occurs prior to the formation of the pronuclear envelope, ruling out a general nuclear import defect. Double immunostaining experiments showed that histone H4 colocalized with H3.3 in peripheral rings in CI embryos (Figure 3B). These abnormal rings of H3.3 and H4 are never observed during pronuclei apposition (Figure 3A′, n>30 for control and CI crosses). This suggests that CI results in a delayed, but not complete inhibition of H3.3/H4 nuclear deposition.

10Once the paternal chromatin is assembled with maternally supplied core histones including H3.3 and H4, the DNA must replicate prior to mitotic entry in both pronuclei. We examined replication timing of pronuclei in control and CI embryos using an antibody directed against the Drosophila Proliferating Cell Nuclear Antigen (PCNA). PCNA is a conserved core component of the replication fork and only present in S-phase nuclei. To confirm this specificity in Drosophila, we examined PCNA localization in early embryos where the S-phase is well characterized with respect to chromosome and spindle morphology (Figure S2). These studies demonstrate that PCNA is nuclear only during S-phase, confirming previous results. Early D. simulans embryos from uninfected and CI crosses were examined from the time of pronuclear migration to pronuclear apposition. In the uninfected crosses, both the male and female pronuclei exhibit robust PCNA staining during their migration, indicating that the S-phase is initiated during the early stages of pronuclei migration (Figure 4A, n>30). We always observed synchronous PCNA staining in both nuclei, indicating simultaneous S-phase initiation in the male and female pronuclei. During pronuclei apposition in the uninfected crosses, we either observe that both pronuclei possess (Figure 4A, “apposition I”) or lack PCNA staining (Figure 4A, “apposition II”). S phase was completed during pronuclear apposition and not earlier. S phase was completed synchronously between male and female pronuclei in 88% of embryos (n = 26, Figure 3A and 3B). We performed the same analysis in embryos derived from the Rescue cross. The results for both pronuclear migration and apposition were very similar to the control cross (n = 27, Figure 4A and 4B).

11Next, we analyzed PCNA staining in embryos derived from the CI cross. As with the control cross, both pronuclei stained positive for PCNA throughout migration (Figure 4A, n>30). Thus, like the control cross, S-phase is initiated simultaneously in the male and female pronuclei during the initial stages of pronuclear migration. Unlike the control crosses, however, we observed 43% of embryos (n = 36) with differential staining during apposition (Figure 4A and 4B). These results indicate that CI delays completion of replication in the male pronucleus. Because the timing of replication initiation does not appear to be altered in CI embryos, it is likely that the replication is slowed down or blocked in the male pronucleus of CI embryos relative to control embryos. Alternate interpretations include delayed release of PCNA or extra DNA replication in CI embryos. However delayed Cdk1 activation in the male pronucleus, presumably due to activation of cell cycle checkpoints, favors a model in which of disrupted replication in the male pronucleus of CI embryos.

12We also examined PCNA staining in control and CI D. simulans embryos that had progressed into prophase as evidenced by condensed DNA, spindle formation, and NEB. In control embryos, PCNA was never localized in the pronuclear DNA after NEB (n = 40, Figure 4C). In CI embryos however, 11% of pronuclei pairs observed after NEB showed a PCNA staining associated with the poorly and unevenly condensed male pronuclear DNA (n = 37, Figure 4C and 4D). Once the male pronuclei of CI embryos progress into metaphase, we no longer observe such PCNA staining.

13It has been reported that PCNA is associated with damaged as well as replicating DNA (for a review see ). We favor a replication defect to explain CI rather than DNA breaks, given that chromatin remodeling defects are strongly associated with replication defects. In addition, chromosome bridging during the first telophase but not free chromosome fragments is well documented in CI embryos. This is more consistent with DNA replication rather than damage defects. Taken together, our data suggest that in CI embryos DNA replication is slowed down or blocked in the male pronucleus.

14Genetic and cellular analyses indicate that CI specifically disrupts paternal chromosome condensation, congression and segregation,. Here we take advantage of anti-acetylated H4 histone antibodies that specifically stain the paternal chromosomes due to nucleosome assembly in the male pronucleus. This enabled us to directly demonstrate the effects of CI are limited to the paternal chromosomes. This implies that CI targets processes specific to the paternal chromosomes necessary for progression through mitosis.

15To identify these processes, we focused on the chromosome remodeling events that are specific to sperm formation and transform the sperm into a male pronucleus. Our cytological examination of protamine deposition and removal did not reveal obvious abnormalities in CI embryos. This of course does not rule out more subtle defects. Protamines are normally removed immediately following fertilization and replaced with the replication-independent variant histone H3.3 and canonical H4, H2A/H2B histones. In CI embryos, a significant fraction of embryos exhibit delays in H3.3 incorporation before completion of the female meiosis. This results in an abnormal ring of H3.3 encompassing the male pronucleus. There is no nuclear envelope present at this early stage, indicating the H3.3 ring phenotype is not due to defects in nuclear import. More likely it is due to a delay in loading H3.3 onto the paternal chromosomes.

16These CI-induced defects in H3.3 deposition are strikingly similar to those reported for mutants in the chromatin remodeling protein CHD1. Male pronuclei from chd1 mutants also exhibit an improper accumulation of H3.3 around the male pronucleus. Like the CI-induced defects, chromosome condensation is severely disrupted presumably due to defects in H3.3-based chromatin remodeling. Mutations affecting HIRA, the H3.3 chaperone, also prevent the formation of condensed paternal chromosomes. These replication-independent histone deposition defects can explain the chromosome condensation and segregation defects observed in CI embryos since H3.3 and H3 share a conserved N terminal tail, whose phosphorylation is crucial for chromosome condensation. Defects in histone deposition can also explain the delayed progression through S phase, as proper nucleosome assembly is required for DNA replication. Both replication dependent and independent nucleosome assembly machineries share common interactors, like the histone chaperone ASF1. ASF1 siRNA knock down experiments and mutants clearly show DNA replication defects. Late DNA replication in ORC2 (Origin Recognition Complex 2) mutants also provoke chromosome condensation defects and reveals that proper replication timing is crucial for the chromatin to be fully competent to condense. However it should be pointed out that chromosome condensation defects alone can produce segregation defects.

17In addition to playing a role in paternal chromatin remodeling, H3.3 plays a more general role in transcription regulation. The replication-independent deposition of H3.3 is correlated with active chromatin states. This raises the intriguing possibility that Wolbachia may influence the transcription state of its host nuclei by altering H3.3 deposition. It has been shown that Wolbachia do not influence the in vivo expression level of antimicrobial peptides specifically, but microarray data from Drosophila cell culture suggest that Wolbachia has some influence on host transcript levels. Another alteration of the host reproduction caused by Wolbachia is a phenomenon called male killing (MK). In male killing, Wolbachia infection results in death of the male but not the female progeny. The resulting increase in the proportion of female progeny is beneficial to the maternally transmitted Wolbachia. Moving a specific Wolbachia strain from one Drosophila species to another results in an instantaneous transition from CI to MK, indicating that these Wolbachia-induced phenotypes share a common molecular mechanism. Studies in Drosophila demonstrate that disruptions in some chromatin remodelers have a much greater impact on organization of the X chromosomes in males than females. This raises the possibility that CI and MK evolved from Wolbachia having a more general effect on the transcriptional state of its host cell by regulating H3.3 deposition.

18To determine whether CI influences replication we monitored for the presence of PCNA, an indicator of replicating DNA, in the male and female pronuclei. This analysis demonstrates that in normal embryos, both initiation and completion of DNA replication occur simultaneously in the two pronuclei. In CI embryos while we find replication is initiated simultaneously, completion of replication is significantly delayed in the male pronucleus. In fact we observe instances of PCNA positive paternal chromosomes during metaphase of the first zygotic division. It is likely that the chromatin remodeling defects described above are responsible for the replication delays of the male pronucleus (see Figure 5). These delays readily account for the extensive chromosome bridging observed during anaphase: segregation of unreplicated chromosomes creates bridges,.

19Delayed completion of replication of the paternal chromosomes provided an opportunity to more precisely determine the timing of CI rescue. Previous studies demonstrated that in the Rescue cross, the chromosome condensation defects at metaphase and segregation defects at anaphase are no longer observed. Additional studies demonstrated that in CI crosses, activation of Cdk1, a highly conserved kinase that drives cells into mitosis in the male pronucleus, is delayed relative to its activation in the female pronucleus. These studies also demonstrated that in Rescue crosses, Cdk1 activation in the male and female pronuclei is synchronous. These studies raise the possibility that Rescue is achieved through correction of cell cycle defects in the male pronucleus. Alternatively, synchrony may be restored by a compensatory slowing of the female pronucleus cell cycle. Our data demonstrate that in Rescue crosses, we no longer observe a discordance in the state of PCNA staining in the male and female pronuclei, indicating the events mediating Rescue occur during interphase prior to Cdk1 activation during prophase. However, these studies do not resolve whether it is due to normalization of the interphase events in the male pronucleus or compensating delay in the female pronucleus. Evidence for the former alternative comes from our observation that unlike CI crosses, in Rescue crosses we never observe PCNA positive chromosomes after entry into metaphase in CI embryos.

20Embryos were collected every 15 minutes and immersed in a pure bleach solution for few seconds to remove the chorion. Next they were washed in distilled water and fixed by vigorous shaking in a 1∶1 heptane/methanol mix. RNAse A (Sigma) treatment was performed for 3 hours at 37°C (10 mg/mL). Primary and secondary antibodies were diluted in PBS+ 0.2% Tween+ 2% BSA. Embryos were incubated overnight at 4°C with primary antibodies. For secondary antibodies, the embryos were incubated at 37°C for three hours.

21The following antibodies were used: Polyclonal anti-Drosophila PCNA (1∶300), polyclonal (1∶1000) and monoclonal (ADL84, 1∶50) anti- Drosophila Lamin (all kindly provided by Paul Fisher), monoclonal anti-alpha tubulin (1∶500, Molecular Probes), polyclonal anti-GFP (1∶500, Chemicon), monoclonal anti-FLAG M2 antibody from Sigma was used to detect flagged H3.3 at 1∶2000, polyclonal anti-acetylated H4 (1∶300, Upstate). Cy5 goat anti-rabbit IgG and Alexa Fluor 488 goat anti–mouse IgG antibodies were used at 1∶150 (Invitrogen). DNA was detected with propidium iodide (Molecular Probes, 1.0 mg/mL solution) after a 20 minute incubation in PBS (1∶50) and a 5 minute wash. To better observe pronuclei deep within the cytoplasm, embryos were cleared and mounted in a (2∶1) benzyl benzoate and benzyl alcohol solution.

22Confocal microscope images were captured on an inverted photoscope (DMIRB; Leitz) equipped with a laser confocal imaging system (TCS SP2; Leica) using an HCX PL APO 1.4 NA 63 oil objective (Leica) at room temperature.

23D. simulans stocks were used as Wolbachia riverside-infected or cured. D. melanogaster stocks were used as cured. The Wolbachia infection status of the stocks was established by both PCR and Propidium iodide staining of fixed reproductive tissues.

24We used the previously described PW8-His3.3-Flag. To construct the PW8-ProtSim-GFP transgene, a D. simulans protamine gene was amplified from genomic DNA using the following pair of primers:

25Primer Protamine simulans 1: GGGAATTCATGCAAATGCCACACCTCCTCAGTC

26Primer Protamine simulans 2: TTGGATCCTTGTTGCAACAAACCCGTCGGCGCT

27This PCR fragment was cloned in the PW8 vector in frame with EGFP at the 3′ end of the protamine coding sequence. A homozygous viable and fertile transgenic PW8-ProtSim-GFP stock was obtained by P-mediated germline transformation of a D. simulans white stock (a gift from Elgion Loreto).