Jagged2a-Notch Signaling Mediates Cell Fate Choice in the Zebrafish Pronephric Duct

1In vertebrates, development of the excretory system is characterized by the successive formation of three distinct kidneys with increased complexity: pronephros, mesonephros, and metanephros. The pronephros is found in all vertebrates, but in mammals it is a nonfunctional transitory structure that is replaced by the mesonephros and then the metanephros. In the early life of fish and amphibians, however, the pronephros is a functional filtration organ that develops very similarly to metanephros, and has been used as a model for kidney development. Nephrons, the fundamental functional units of the kidney, possess several segments, which regulate fluid balance, osmolarity, and the disposal of metabolic waste products. While pronephroi in amphibians and fish contain two functional nephrons, the metanephroi of mammals have millions of nephrons. The zebrafish pronephros consists of paired glomeruli coalescing at the midline ventral to the dorsal aorta, and two pronephric tubules that project bilaterally from the glomeruli to the pronephric (Wolffian) ducts that run caudally and fuse just before their contact with the exterior at the cloaca. The glomerulus is the site of blood filtration. Epithelia of the tubules are the primary site of selective reabsorption and secretion, while the duct carries the modified urine to the outside world. Though quite uniform in appearance, the tubule and duct epithelia are further subdivided into distinct segments, recognized by the expression of specific membrane transporters. This is a general feature of vertebrate kidneys, where osmoregulatory function depends on an organized disposition of different transporters operating sequentially along the nephron.

2Morphogenesis and cell fate determination of different nephric segments have attracted much attention recently. Multiple transcription factors and signaling pathways have been shown to be involved in these processes in different model organisms. Wnt4 is essential for tubulogenesis in mouse metanephroi and Xenopus pronephroi. Brn1 is required for the development of Henle's loop, the distal convoluted tubule, and the macula densa in mice at the primitive loop stage, and so is pax2a for the differentiation of proximal tubule and duct epithelial cells and cloaca morphogenesis in zebrafish. Some segments of the nephron comprise only one cell type, while others include two or more cell types. The mammalian collecting duct contains two major cell types: principal cells (for salt and water absorption) and intercalated cells (for acid/base transport). It was reported that Foxi1 plays a crucial role in the specification of intercalated cells.

3Notch signaling is an evolutionarily conserved pathway that multicellular animals use in regulating pattern formation and cell fate determination through local cell interactions. One of the well-known mechanisms of Notch signaling is lateral inhibition during neurogenesis: initially equivalent cells differentiate into a “salt and pepper” pattern of cells with different fates via a regulatory loop. Notch is a transmembrane receptor that interacts with Delta and Serrate/Jagged ligands. Ligand-activated intramembrane proteolysis, which is partly through the γ-secretase activity of Presenilin, is required to release the Notch intracellular domain (Notchicd), which is then translocated to the nucleus, where Notchicd and CSL (CBF1/RBPjκ, Su(H), and Lag-1) proteins bind and activate downstream target genes, such as Hairy/Enhancer of split related (Hes/her) homologs. Ubiquitylation is a multistep process that results in the conjugation of Ubiquitin to a substrate protein. Recent studies have identified the roles of Neuralized and Mind bomb (Mib) in ligand ubiquitylation and endocytosis, which is essential for activating Notch. Similarly, Jagged2 is ubiquitylated by a Mib paralog, Skeletrophin.

4Notch signaling is required for the development of different kidney segments. By manipulating Notch activity, Notch signaling in the tubule was shown to inhibit duct fate in the dorsoanterior Xenopus pronephric anlage and to control subsequent tubule patterning. Homozygous Notch2del1, a hypomorphic allele, and transheterozygous Notch2del1/Jag1dDSL mice exhibit a similar glomerular defect: lack of capillary tufts and mesangial cells. Presenilin is indispensable for the formation of mouse proximal tubules and glomerular podocytes. Zebrafish jagged1b/jagged2a double morphants have small glomeruli or segments of glomerulus replaced by dilated blood vessels.

5Our analysis of zebrafish pronephric ducts revealed that the distal ducts are composed of two types of epithelial cells: multi-cilia cells and principal cells. We showed that multi-cilia cells interpolate principal cells and that their differentiation is mediated by Jagged2a-Notch1a/Notch3-Her9 signaling. We also demonstrated that this differentiation process requires Mib, an E3 ligase that facilitates Jagged2a endocytosis, and, hence, activates Notch signaling. This is the first time, to our knowledge, that Jagged2-Notch signaling has been shown to mediate cell fate determination within a kidney segment, but not between segments, via a lateral inhibition mechanism.

6Acetylated tubulin staining revealed that stumpy single primary cilia are present in the pronephric duct as early as the 20 somite stage (ss) (unpublished data). Cilia tufts or multi-cilia appeared later and were fully formed by 36 h post-fertilization (hpf). These cilia tufts were located along the distal pronephric duct between the proximal pronephric duct and cloaca, corresponding to somites 8–14 (Figures 1A, S1, and S3). Pericentriolar material 1 (Pcm1) staining of 36-hpf embryos revealed that multiple basal bodies are associated with each cilia tuft (Figure 1B–1D) and Pcm1 is colocalized with γ-tubulin at the apical site of epithelial cells (Figure S2). To determine if each cilia tuft is generated from a single cell, we used antibodies against a membrane marker, wheat germ agglutinin (WGA), and a tight junction marker, Zonula occludens-1 (Zo-1). Triple labeling of Pcm1, acetylated tubulin, and WGA demonstrated that cilia tufts are in the lumen of the duct and that multiple basal bodies are within one cell. Individual Pcm1 staining was also found in the neighboring cells corresponding to individual basal bodies of the primary cilia (Figure 1E). Immunostaining of Zo-1 and Pcm1 confirmed that multiple Pcm1-staining basal bodies are localized to the apical side of one cell in the pronephric duct (Figure 1F).

7Cilia identity was further confirmed by transmission electron microscope imaging of a transverse section of the distal duct of 36-hpf embryos. We found two types of cells: cells with a cilia tuft of at least 15 cilia, and neighboring cells with a single primary cilium. All cilia tufts and primary cilia projected along the axis of the duct lumen and were of the typical 9 + 2 structure (Figure 1B and 1G), suggesting that they are motile. Indeed, it was demonstrated that cilia in the zebrafish duct are motile, generating a corkscrew-like wave pattern in the duct lumen directed toward the cloaca.

8In mammals, collecting ducts are composed of two major cell types: principal cells and intercalated cells. Na+, K+ ATPases transport numerous solutes and water across epithelia and are only expressed in the principal cells. The zebrafish counterparts are expressed in the pronephric duct. However, a meticulous examination of Na+, K+ ATPase α1a2 and Na+, K+ ATPase β1a expression using in situ hybridization revealed that these genes are not expressed in all the duct cells (Figure 1H–1K). Some sodium pump-negative cells interpolated principal cells. To investigate their identity, we cloned the zebrafish homologs and examined the expression patterns of pendrin1, pendrin2, rhcg, and vacuolar-type ATPase B, all of which are marker genes in mammalian intercalated cells (see Materials and Methods). Although they were expressed in other tissues, none of these genes were expressed in the duct up to 72 hpf, suggesting that the sodium pump-negative cells are not intercalated cells (unpublished data). To determine whether they are multi-cilia cells, we cloned ciliogenic genes and analyzed their expression in the duct. Zebrafish rfx2 is the homolog of Caenorhabditis elegans daf-19, which controls cilium formation in sensory neurons. Zebrafish centrin2 is the homolog of mouse Centrin2, which associates with centrosome-related structures of the basal bodies of the ciliated cells. In addition to the ciliated tissues, including Kupffer's vesicle, olfactory pits, hair cells of the otic vesicle, and the neural tube (unpublished data), rfx2 and centrin2 were expressed in a mosaic pattern in the duct at 36 hpf (Figure 1L–1N). Furthermore, fluorescent double in situ hybridization of rfx2 and Na+, K+ ATPase β1a revealed a mutually exclusive pattern (Figure 1O–1Q). This indicates that multi-cilia cells and principal cells are two distinct cell populations in the zebrafish distal pronephric duct.

9Notch signaling has been shown to be required for differentiation of ciliated cells in Xenopus skin and in sensory patches of the zebrafish inner ear. The mosaic pattern of multi-cilia cells and principal cells prompted us to explore whether Notch signaling is required for their differentiation in the pronephric duct.

10Among four known Notch receptors, notch1a and notch3 were found to be expressed in the intermediate mesoderm (IM) in early stages and later in the duct. notch1a was expressed in the IM from 1 ss and subsequently in the distal duct region at 18 ss (Figure 2A and 2B). notch1a expression, however, was not detected in the duct after 20 hpf. notch3 was expressed in the IM from 1 ss onward and in the entire duct region, with a higher level of expression in the distal part, at 24 hpf (Figure 2C and 2D), where expression persisted until at least 48 hpf.

11There are nine known zebrafish Notch ligands: deltaA, deltaB, deltaC, deltaD, dll4 (M. M. and Y.-J. J., unpublished data), jagged1a (also known as jagged1 or serrateC), jagged1b (also known as jagged3 or serrateA), jagged2a (also known as jagged2 or serrateB), and jagged2b (M. M. and Y.-J. J., unpublished data). Of the ligands, deltaC is expressed in the anterior IM, presumably in the glomerulus, from 4 ss to 18 hpf, and jagged1b is expressed in the developing proximal tubule. jagged2a expression in the IM appeared gradually from anterior to posterior, spanning from somite 3 to somite 13 at 15 ss (Figure 2E–2G). In the posterior IM, jagged2a expression displayed a salt-and-pepper-like pattern (a mixture of high- and low-expressing cells) from 17 ss to 20 ss (spanning from approximately somite 9 to somite 13) (Figure 2H and 2I). Beginning with 20 ss, jagged2a expression was limited to individual cells; this pattern persisted in the pronephric duct until at least 48 hpf (Figure 2J and 2K). jagged2a was also expressed in the proximal duct (Figure 2E–2J), and a description of its function there will be published elsewhere. Here, we only explore the function of jagged2a in the distal pronephric duct.

12We further examined the expression of published Notch downstream targets, hairy/enhancer of split related (her and hey) genes, by doing in situ hybridization to detect her1, her2, her3, her4, her6, her7, her8, her9, hey1, hey2, and heyL; or by checking the deposited expression patterns in the ZFIN database (http://www.zfin.org) of her5, her12, and hes5. Only two of the her genes were expressed in the IM. her6 appeared between the tailbud stage and 10 ss but expression was not maintained in later stages. her9 expression was not detected in the duct domain before 15 ss (unpublished data). However, it was expressed in the distal duct from 17 ss. This correlates temporally with mosaic expression of jagged2a in the same region (Figures 2L and S3). Spotted and uneven her9 expression persisted in the duct till about 21 hpf and disappeared afterwards (Figure 2M).

13Since Jagged2a presumably starts signaling to the neighboring cells from 17 ss onwards, we investigated the onset of multi-cilia cell differentiation by examining the expression of rfx2 and centrin2 at earlier stages. Interestingly, rfx2 expression in the IM and duct was similar to that of jagged2a. rfx2 expression was uniform in all duct cells before 15 ss, which is consistent with the fact that all cells have cilia—either cilia tufts or a single cilium—in this kidney segment. Its expression was then limited to single cells in the distal duct from 17 ss until at least 36 hpf (Figure 3A–3D). Similarly, centrin2 expression was limited to single cells from 20 ss onwards (unpublished data). These observations suggest that multi-cilia cells are jagged2a-expressing cells. Indeed, jagged2a and rfx2 transcripts were colocalized in individual cells from 17 ss to at least 36 hpf (Figure 3E–3J). Furthermore, when we investigated whether her9 is expressed in the same distal duct domain as rfx2, we found that although her9 was expressed in the same domain, it was expressed primarily in non-rfx2-expressing cells (Figure 3K–3M).

14The above finding suggests that Jagged2a regulates differentiation of multi-cilia cells and principal cells. We designed morpholino antisense oligonucleotides (MOs) to knock down the function of Jagged2a, and used the mibta52b mutant to study the function of the Jagged2a-Notch pathway in differentiation. In addition to two MOs, jagged2a-atg and jagged2a-utr, designed to be antisense to the jagged2a translation start site and the 5′ UTR, respectively, one MO (jagged2a-sp) was designed to block RNA splicing between exon 1 and intron 1. The jagged2a-sp MO effectively blocked splicing until at least 48 hpf (Figure 4A) and the jagged2a-utr MO was specific in a sequence-dependent manner (Figure S4A–S4F). jagged2a MOs did not affect duct development (Figure 4B). jagged2a-atg morphants displayed uniform rfx2 (100%, n = 242) and centrin2 (89%, n = 224) expression in almost all of the duct cells, in contrast to a mosaic pattern found in wild-type (wt) embryos (Figure 4C–4F). Similar results were found in jagged2a-utr morphants (Figure S4F; Table 1). Furthermore, we observed that Pcm1 and acetylated tubulin were significantly increased in jagged2a-sp morphants (100%, n = 7; Figure S5A–S5F). In contrast, Na+, K+ ATPase β1a expression was highly reduced in the duct of jagged2a-atg morphants at 24 hpf (100%, n = 22; Figure 4G and 4H) and 36 hpf (100%, n = 40; unpublished data). Similarly, we observed multi-cilia cell hyperplasia in mibta52b mutants as evidenced by rfx2 expression (Figure 4I and 4J) and immunostaining of acetylated tubulin and Pcm1 (Figure S5G–S5I). Statistically, mibta52b mutants generated greater than 2-fold more multi-cilia cells than wt embryos (Table 1). Consistently, principal cells were decreased dramatically in mibta52b mutants, as shown by Na+, K+ ATPase α1a2 expression at 24 hpf (Figure 4K and 4L).

15While the number of rfx2-expressing cells was dramatically increased in jagged2a-sp morphants and mibta52b mutants (Table 1), only three to five Na+, K+ ATPase β1a-expressing cells were found in the jagged2a-sp morphants (89%, n = 19), and a dramatically decreased number of Na+, K+ ATPase β1a-expressing cells were found in mibta52b mutants (Figure 4M–4O). Similarly, double immunostaining with α6F (raised against the chick α1 subunit of the Na+/K+ ATPase) and Pcm1 showed that most of the duct cells adopted a multi-cilia cell fate and expressed Pcm1; only two to three cells were positive for the principal cell maker α6F in the distal duct of jagged2a-sp morphants (93%, n = 15), and principal cells were dramatically decreased in mibta52b mutants (Figure 4P–4R). This observation suggests that the multi-cilia cell hyperplasia in jagged2a morphants and mibta52b mutants is at the expense of the principal cells through lateral inhibition (see below). It is unlikely to be due to an inhibitory activity of Jagged2a on proliferation of multi-cilia cells, since there is no difference in cell proliferation between wt embryos and jagged2a morphants (unpublished data). The phenotypic severity of mibta52b was not as strong as that of jagged2a morphants (Table 1), indicating that some residual Notch activity remains in mibta52b mutants, as reported previously.

16mibta52b mutants display a global compromise in Notch activation, and mib was identified to encode an E3 ligase that activates Notch signaling by ubiquitylating and endocytosing Delta.

17The phenotypic analysis of multi-cilia cells and principal cells in the duct suggests that mib genetically interacts with jagged2a. Since Delta has been shown to be a substrate of Mib and endocytosed after ubiquitylation, we asked if Mib physically interacts with Jagged2a, as shown for a human Mib paralog, Skeletrophin. We checked the in vivo interaction of Jagged2a and Mib by immunoprecipitation and cotransfection experiments. Indeed, Mib bound to full-length Jagged2a and Jagged2aicd (Figure 4S). Moreover, Myc-Jagged2 was localized to the cell surface (membrane) and cytoplasm when transfected alone (Figure 4T) and to the perinuclear granules when cotransfected with Flag-Mib (Figure 4U). The fact that Mib binds Jagged2a and facilitates its internalization suggests that Mib regulates Jagged2a in a way similar to Delta.

18In the duct, we observed slight multi-cilia cell hyperplasia in notch1a/des (deadly seven) mutants and notch1a morphants (Figure 4W; Table 1). notch3-utr MO and notch3-sp splicing MO against the exon 1-intron 1 boundary were designed; the former was specific in a sequence-dependent manner (Figure S4G–S4L) and the latter was able to induce splicing defects until at least 48 hpf (Figure S4M). More multi-cilia cells were found in notch3 morphants (Figure 4X; Table 1). The stronger cilia phenotype seen in notch3 morphants compared with that of notch1a mutants or morphants was consistent with the persistent notch3 expression in the pronephric duct and also demonstrated that Notch3 plays a more important role than Notch1a.

19Loss of function of a single Notch receptor resulted in a phenotype that was less severe than that of jagged2a morphants. This suggests that Notch1a and Notch3 act redundantly. In fact, 91.1 ± 12.2 multi-cilia cells were generated in notch3-sp MO-injected desth35b mutants in contrast to 42.9 ± 4.7 and 55.7 ± 12.2 multi-cilia cells in notch1a-sp and notch3-sp morphants, respectively (Figure 4V–4Y; Table 1). However, the multi-cilia cell phenotype in notch3-sp MO-injected desth35b mutants was not as severe as that of jagged2a morphants (Table 1). Consistently, Na+, K+ ATPase β1a down-regulation in notch3-sp MO-injected desth35b mutants was not as severe as that in jagged2a morphants (unpublished data). These data suggest that there may be a yet-unidentified Notch involved in this differentiation process.

20The temporal and spatial expression of her9 in the distal pronephric duct suggests that it is one of the downstream target genes of Jagged2a-Notch1a/Notch3 signaling. We asked whether activation of her9 in the duct requires Jagged2a, Notch1a, and Notch3. her9 expression in the pronephric duct was reduced in jagged2a-sp morphants (77%, n = 54; Figure 5A and 5B). While her9 expression was slightly reduced in desth35b/notch1a mutants (Figure 5C and 5D) and in notch3-sp morphants (100%, n = 45; Figure 5E), its expression was almost completely lost in notch3-sp MO-injected desth35b mutants (94%, n = 36; Figure 5F). Similarly, its expression was almost completely lost in mibta52b mutants (Figure 5G and 5H). We next examined whether her9 is activated by Notch1a and Notch3. The constitutively active form, the intracellular domain (icd) of both Notch1a and Notch3, were used. her9 expression was activated by both Notch1aicd (22%, n = 98; Figure 5I–5K) and Notch3icd (17%, n = 70; unpublished data). These experiments demonstrate that the activation of her9 expression in the pronephric duct requires Notch1a and Notch3, in addition to Jagged2a and Mib.

21We further studied her9 function in the duct with her9-atg (effectiveness verified in) and her9-utr MOs. her9 morphants exhibited multi-cilia cell hyperplasia, as demonstrated by rfx2 expression (Figure 5L and 5M; Table 1). The requirement of Jagged2a, Notch1a, and Notch3 for activation of her9 expression in the duct, and the multi-cilia cell hyperplasia in her9 morphants demonstrate that Her9 acts downstream of the Jagged2a-Notch1a/Notch3 pathway. However, multi-cilia cell hyperplasia in her9 morphants was not as severe as that in jagged2 morphants or notch3-sp MO-injected desth35b mutants (Table 1). One possibility is that Her9 is not completely knocked down by her9 MOs, because of the potential negative autoregulatory feedback on the transcription by its protein, similar to Hes7. Alternatively, there may be more effector(s) working in parallel with Her9. The latter explanation is particularly likely, since the her9 expression domain only partially overlaps with that of jagged2a (Figure S3).

22rfx2 and jagged2a displayed mosaic patterns from 17 ss onwards (Figure 3E and 3F); her9 was expressed in the distal duct domain from 17 ss onwards (Figures 2L and 3L). Moreover, her9-expressing cells were not multi-cilia cells (Figure 3K–3M). The dynamic expression of these genes suggests that multi-cilia cells start to differentiate from 17 ss onwards. We next investigated whether Jagged2a-Notch signaling is required from as early as 17 ss. We found that rfx2 expression is uniform in the IM in wt embryos (Figure 6A), mibta52b mutants (Figure 6B), and jagged2a-sp morphants (91%, n = 33; Figure 6C) at 15 ss, while a neurogenic phenotype was obvious in mibta52b mutants, indicating that multi-cilia cells do not start to differentiate before 15 ss. However, when rfx2 expression was limited to individual cells at 18 ss in wt embryos (Figure 6D), rfx2-expressing cells were increased in the mibta52b mutant (Figure 6E) and jagged2a-sp morphants (90%, n = 43; Figure 6F). Similarly, her9 and notch3 morphants exhibited multi-cilia cell hyperplasia from as early as 17 ss (unpublished data). These data indicate that Jagged2a-Mib-Notch3-Her9 is required for cell differentiation from as early as 17 ss.

23Multi-cilia cell hyperplasia is found in the mutants and morphants defective in the Jagged2a-Notch1a/Notch3-Her9 pathway. The increase of multi-cilia cells is most likely at the expense of principal cells, since no cell proliferation and apoptosis were detected in the duct of either wt or mibta52b embryos (Figure 7A–7F; Videos S1 and S2). Thus, we demonstrated that Jagged2a-Notch1a/Notch3-Her9 is required for specification of multi-cilia cells and principal cells through a lateral inhibition mechanism. We next asked whether duct cells will adopt a principal cell fate if Notch is constitutively activated in the duct. We crossed transgenic lines hsp70:Gal4 and UAS:myc-notch1a-intra and induced the expression of constitutively active Notch (Notch1aicd) by heat-shock from 6–8 ss. Fluorescent double in situ hybridization with rfx2 and Na+, K+ ATPase β1a at 24 hpf revealed that multi-cilia cells (rfx2-expressing cells) interpolate principal cells (Na+, K+ ATPase β1a-expressing cells) in control embryos (heat-shocked hsp70:Gal4 only) (100%, n = 4; Figure 7G), while principal cells are uniformly present at the expense of multi-cilia cells in hsp70:Gal4/UAS:Notch1aicd embryos (100%, n = 9; Figure 7H). This confirms that Notch signaling makes binary choices between multi-cilia cells and principal cells in the pronephric duct.

24In this paper, we have shown that there are two major epithelial cell types found in the zebrafish distal pronephric duct. The mosaic pattern of multi-cilia cells and principal cells is controlled by Jagged2a/Notch-mediated lateral inhibition. Using available mutants and morphants deficient in genes functioning in Notch signaling, we demonstrated that one ligand, Jagged2a; two receptors, Notch1a and Notch3; and one downstream effector, Her9, are required for the differentiation and patterning of these two cell types. In addition, we showed that Mib is essential for this process, since it interacts with Jagged2a and facilitates Jagged2a internalization. In summary, our findings indicate a new function of Notch signaling in cell fate choice within a zebrafish kidney segment.

25Interestingly, such a function of Jagged2-Notch signaling has not to our knowledge been found in mammals, although Jagged2 is expressed in the postnatal murine kidney. This may be due to the early lethality of Jagged2 knockouts, which prevents the detection of such a function in metanephric kidneys. There are two zebrafish Jagged2 homologs, jagged2a and jagged2b. Most likely, the subfunctionalization of these two genes makes it possible for us to identify the function of jagged2a in zebrafish pronephros. Our findings warrant further study of the role of Jagged2 in mammalian kidneys by conditional knockouts.

26The physiological functions of multi-cilia cells and principal cells are apparently different. While motile cilia on the apical side of the multi-cilia cells propel urea along the lumen of the pronephric duct, principal cells, which account for the majority of the cells in the kidney, reabsorb ions and other molecules according to fluid balance requirements. A plausible physiological significance of the interpolating pattern of multi-cilia cells and principal cells may be to coordinate the movement of the fluid and the process of reabsorption of the ions and other small molecules.

27Notch signaling is used for binary cell fate specification in many developmental processes. Notch activation in the signal-receiving cells inhibits them from expressing a set of genes leading to one fate and diverts them to an alternative program of differentiation. Consistent with other recent expression studies in mice, chicks, and zebrafish, we found that the temporal and spatial expression patterns of notch1a, notch3, and jagged2a fulfill their predicted roles in a multi-cilia cell to principal cell inhibitory signaling process in the zebrafish distal pronephric duct (Figure 8). While the expression of Notch receptors is evident throughout the duct epithelium, jagged2a expression becomes restricted to developing multi-cilia cells (Figure 3G and 3J). In addition, her9 is expressed unevenly within this domain and most her9-expressing cells are not colocalized with the multi-cilia cells (Figure 3M). Our observations support the notion that lateral inhibition regulates cell characters in the distal pronephric duct. In all of the mutants/morphants, Jagged2a-Notch signaling is thought to be blocked to different degrees, and many to almost all epithelial cells in the zebrafish pronephric duct become positive for rfx2 and Pcm1, implying that they have adopted a multi-cilia cell—rather than a principal cell—character.

28The studies shown here exemplify a very striking parallel between the role of Jagged2-Notch in the distal pronephric duct and the inner ear, and that of Delta-Notch signaling in neural tissue, the inner ear, and the intestine. In all of these cases, the obstruction of Notch signaling leads to a failure in lateral inhibition and to a great excess of one cell type at the expense of another. The supernumerary cell types are multi-cilia cells in the distal pronephric duct (this study), hair cells in the ear, neurons in the neural system ( and reviewed in), and secretory cells in the gut. Similar to Delta-Notch signaling, the blockage of Jagged2a-Notch signaling results in an up-regulation of jagged2a expression, implying that expression of jagged2a itself is negatively regulated by Notch activity. If a cell in the wt organism expresses jagged2a, thereby activating Notch in neighboring cells, it will not only inhibit these neighbors from adopting the primary fate, but it will also down-regulate their expression of jagged2a. This generates a feedback loop that, over time, tends to amplify differences between adjacent cells so as to create a mixture of different cell types (Figure 8;).

29Multi-cilia cells are largely absent in mammalian kidneys, even though the primary cilium is present on principal cells of the tubule segment. We found interpolating multi-cilia cells and principal cells in the zebrafish distal pronephric duct. This mosaic cell pattern has been shown to be present in other anamniote vertebrates including marine teleosts, lampreys, and amphibians. Notch signaling was required for the differentiation of speckled 4A6-positive cells in the posterior duct of Xenopus. Our findings in zebrafish multi-cilia cells and the conserved pattern of cilia cells in amphibians suggest that 4A6-positive cells are multi-cilia cells and that, in general, lateral inhibition may be involved in establishing the interpolating pattern of multi-cilia cells and principal cells in the ducts of anamniote vertebrates.

30The renal collecting duct of mammalian kidneys comprises various kinds of intercalated cells (mediating acid and base transportation), principal cells (responsible for salt and water absorption), and inner medullary cells, which moderate all three types of transport. Inner medullary cells are “hybrid” cells—positive for both intercalated and principal cell markers. Since Jagged1 expression and a similar mosaic pattern of intercalated cells and principal cells were observed in the collecting ducts of mouse kidneys, it is tempting to speculate that Notch signaling is involved in the differentiation and patterning of these different cell types in the mammalian collecting duct.

31The efferent duct transports material from the rete testis to the epididymis by motile cilia. Similarly, multi-cilia cells and principal cells are found exhibiting a mosaic pattern in the efferent duct of reptile (turtle,) and mammal (rat,). It would be interesting to see how these two cell types differentiate and whether Notch signaling is involved in this differentiation process.

32Fish were maintained and raised as described. mibta52b, desth35b, hsp70:Gal4, and UAS:myc-notch1a-intra mutants or transgenic lines were described before.

33Primers based on zebrafish cDNAs or ESTs were designed (rfx2, forward: CTCACTCCTCACGCTCATCATC, reverse: CATAGGGTTTGAGCACCTGAT; centrin2, forward: TCAAAATGGCGTCCGGCTTC, reverse: GACACACTAGGTCTTAAAGG; vhatpb1, forward: TGCCTATGACAACAGAACG, reverse: CAAAGCACAGACGCTGTAAAC; vhatpb1-2, forward: ACTACCCTCTTTGTCTCGA, reverse: CGAAGCAAGTGGTCACATAC; rhcg, forward: GTAATCATGGAGACGGTCAG, reverse: GACAATGATCCGAACAGCAG; pendrin1, forward: CTCAACGAACGCTTCAAGAAG, reverse: CTGCTACATCCAGCAAGTAC; pendrin2, forward: CTGGATGTTGTGATGGAGC, reverse: AGAACACGCTCCAGTCTGAG; slc4a2/ae2, forward: GACTGCGCAACTTTGAGTCACGCAGTAGTG, reverse: CCAGGAATGAGGTCATACTGGCATTTGCATC; ret1, forward: GTTCACTACGTAACTTCCTG, reverse: CTATCGATTGTGTCCACG) and PCR-amplified products were purified and cloned into pGEMT-easy vector (Promega, http://www.promega.com). Together with Na+, K+ ATPase α1a2 and Na+, K+ ATPase β1a, her9, jagged2a, notch1a, and notch3 (previously annotated as notch5 in and changed according to the nomenclature in ZFIN, http://www.zfin.org), antisense probes were synthesized and whole-mount in situ hybridization was performed as described. Whole-mount in situ embryos were embedded in Jung Tissue Freezing Medium (Leica, http://www.leica-microsystems.com), cryosectioned at 10 μm, and mounted in 70% glycerol. Images were taken with a Zeiss Axioplan microscope (http://www.zeiss.com) or a Leica MZ16 dissecting microscope equipped with SPOT INSIGHT (Diagnostic Instruments, http://www.diaginc.com).

34To achieve maximal knockdown effect, 1.15 nl of serially diluted MOs (2.3 mM, 1.15 mM, 0.58 mM, and 0.29 mM; Gene Tools, http://www.gene-tools.com) was injected into embryos at the 1- to 2-cell stage. The maximal dosages that caused no obvious toxic effect on embryogenesis were as follows: jagged2a-atg (−22 to +3) MO: CATGCCGCCGATTTGATGTGTTATA, 2.30 pM; jagged2a-utr (−69 to −45) MO: ATGACCGGCGACAGGATCCTCCGTT, 0.29 pM; jagged2a-sp MO: AATCAGAGCTCTCACCTTCGTCCAC, 0.29 pM); notch3-utr (−76 to −51) MO: ACATCCTTTAAGAAATGAATCGGCG, 0.38 pM; notch3-sp MO: AAGGATCAGTCATCTTACCTTCGCT, 0.29 pM; her9-atg MO: CTCCATATTATCGGCTGGCATGATC, 1.15 pM; her9-utr (−62 to −38) MO: AGTGAATATATTCCGTGTGTGGTTT, 0.29 pM; and notch1a-sp MO: GTAGTGTTAAACTGTTACCTTGTGC, 2.30 pM.

35The knockdown efficacy of the splicing MOs was checked by reverse transcriptase PCR (RT-PCR) with the following primers: jagged2a-sp MO, forward: GGAATTGGCTCCCAATCGCGTGCCT, reverse: CCACCAAGAACGTCGGTAGATCCAG; notch3-sp MO, forward: CTGGAGGTATTTCGAGACGCACGGCAG, reverse: GCATCTTGAATCAATGCACATTCCTCC; and notch1a-sp MO, forward: CTTCTGCACTTTCTGGAGATTTAAAGAAG, reverse: GATGCTTCTCCGCTGGGCTTGTACTCGC and GCAACAAGTGACGCTCAAAGCGCAAGTTG (for spanning intron).

36To examine the knockdown specificity of jagged2a-utr MO and notch3-utr MO, we cloned the 5′ UTR of both jagged2a (−130 to +3) and notch3 (−226 to +3) to the EcoRI and XbaI sites of pCS2-XLT-GFP vector. Plasmids were linearized with NotI, and mRNA syntheses were carried out with mMessage mMachine Kit (Ambion, http://www.ambion.com). Then, 250 pg of mRNA, 250 pg of mRNA with utr-MO, and 250 pg of mRNA with mis-match-utr-MO were injected into eggs at the one-cell stage. Green fluorescent protein (GFP) was examined under a Leica dissecting microscope, and images were taken by the equipped Nikon Digital (DXM1200F; Nikon, http://www.nikon.com) at 24 hpf. The sequences of the five-mismatch MOs (in lower case, designed by Gene Tools) are as follows:

375mis-jagged2a-utr (−69 to −45) MO: ATcACgGGCGAgAGGATCgTCCcTT and 5mis-notch3-utr (−76 to −51) MO: AgATgCTTTAAcAAATcAATCGcCG.

38We used mRNA of notch1aicd and notch3icd to examine the effect of Notch activation on her9 expression. pCS2-myc-notch1aicd and pCS2-myc-notch3icd were linearized with NotI, and mRNA synthesis was carried out with mMessage mMachine Kit (Ambion). Then, 100 pg of notch1aicd or 100 pg of notch3icd mRNA was coinjected with 50 pg of GFP mRNA into one blastomere of two-cell-stage embryos. The mRNA-containing side was traced by following GFP expression, and mRNA functional expression was recognized by disrupted somite boundaries.

39Whole-mount antibody staining was performed on embryos fixed in 4% PFA or methanol: DMSO (80:20) as described. The following antibodies and their dilution were used: acetylated tubulin and γ-tubulin, 1:500 (Sigma-Aldrich, http://www.sigmaaldrich.com); anti-Pcm1, 1:200; monoclonal Zo-1, 1:20; monoclonal α6F, 1:5 (Developmental Studies Hybridoma Bank, http://www.uiowa.edu/~dshbwww); monoclonal phospohistone H3 (Ser10) (6G3), 1:40 (Cell Signaling Technology, http://www.cellsignal.com); rabbit anti-Pax2, 1:100 (Covance, http://www.covance.com); Alexa 488-goat anti-mouse and Alexa 568-goat anti-rabbit, 1:400 (Molecular Probes, http://probes.invitrogen.com); and Alexa 350-WGA, 1: 1,000 (Molecular Probes). The TUNEL assay was performed as described in the product manual of the In Situ Cell Death Detection Kit AP (Roche, http://www.roche-diagnostics.com). Whole-mount embryos were embedded in Jung Tissue Freezing Medium (Leica), cryosectioned at 10 μm, and mounted in FluorSave reagent (Calbiochem, http://www.emdbiosciences.com). Images were taken using a Zeiss Confocal LSM 510 or an Olympus Fluoview FV1000 microscope (http://www.olympusamerica.com), and 3-D movies were generated using FV10-ASW1.5 software.

40Embryos were fixed with 2% paraformaldyhyde and 4% glutaraldehyde in 100 mM cacodylate buffer for 3 h and post-fixed with 2% osmium tetroxide in 100 mM sodium cacodylate buffer for 1 h at 4 °C. Embryos were then dehydrated through a series of 30%, 50%, 70%, 90%, and 100% ethanol, and finally in propylene oxide prior to infiltration with spurr resin. Embryos were embedded in 100% spurr resin and polymerized at 65 °C overnight. Ultra-thin sections were cut on a Jung Reichert ultramicrotome (http://www.leica-microsystems.com) and examined with a transmission electronic microscope (JEM1010, JEOL, http://www.jeol.com) at 100 kV.

41The method was as previously described except that substrates fluorescein-tyramide and Cy3-tyramide were respectively replaced with Alexa 488-tyramide and Alexa 568-tyramide (Molecular Probes). The substrates are diluted in amplification buffer/0.0015% H2O2 according to the product manual. Images were taken using a Zeiss Confocal LSM 510.

42Embryos (6–8 ss) from hsp70:Gal4 (homozygous) and UAS:myc-notch1a-intra (heterozygous) crossings were transferred to petri dishes with prewarmed (39 °C) egg water and incubated at 39 °C incubator for 40 min. Embryos were transferred to Petri dishes with 28 °C egg water afterwards and incubated at 28 °C until 24 hpf. The embryos in which Notch was activated were recognized by their short body axis.

43pCS2-myc-Jagged2a and pCS2-myc-Jagged2aicd were cloned by in-frame fusion of jagged2a and jagged2aicd fragments to pCS2-myc vectors. The domain was predicted by the SMART program (http://smart.embl-heidelberg.de). pCS2-Flag-Mib was cloned by in-frame fusion of mib to the pCS2-Flag vector.

44COS7 cells were transfected with 10 μg of plasmid DNA in 10-cm dishes using Dotap liposomal transfection reagent (Roche). Cells were harvested 2 d after transfection and lysed in lysis buffer (50 mM Tris-HCl [pH 8.0], 150 mM NaCl, 0.5% NP40, 0.5% deoxycholic acid, and 0.005% SDS). Lysates were centrifuged and the supernatant was incubated with Anti-Flag M2-Agarose Affinity Gel (Sigma-Aldrich) for 2 h. The beads were washed with lysis buffer seven times and with TBS (50 mM Tris-HCl [pH 8.0], and 150 mM NaCl) two times and boiled in SDS gel loading buffer. Eluted proteins were electrophoresed on an SDS-polyacrylamide gel and transferred to a nitrocellulose membrane (Stratagene, http://www.stratagene.com). Membranes were incubated with primary antibody (rabbit anti-Myc, 1: 1,000 [Santa Cruz Biotech, http://www.scbt.com]) for 2 h and secondary antibody (anti-rabbit-hrp, 1:5,000 [Dako, http://www.dako.com]) for 1 h. The signals were visualized with a chemiluminescence detection system (Pierce, http://www.piercenet.com). Then membranes were striped with 1× Re-Blot Plus Strong Solution (Chemicon, http://www.chemicon.com) and reblotted with rabbit anti-Flag, 1:1,000 (Sigma-Aldrich).

45After a 24-h transfection, COS7 cells were fixed in methanol at 20 °C for 5 min and air-dried. Fixed cells were then incubated in blocking solution (10% goat serum in PBS) for 1 h, followed by staining with the appropriate primary antibodies (rabbit anti-Myc A14 [Santa Cruz Biotech] and mouse monoclonal anti-Flag M2 [Sigma-Aldrich], 1:1,000) in blocking solution for 1 h at room temperature. Subsequently, cells on coverslips were washed three times with PBS and incubated with Alexa 568-goat anti-rabbit antibody and Alexa 488-goat anti-mouse antibody (Molecular Probes). Coverslips were washed three times, mounted on glass slides, and observed under a Zeiss Confocal LSM 510.

46The National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov) accession numbers for the genes discussed in this paper are centrin2,CF269323; jagged1a (also known as jagged1 or serrateC), AY221107; jagged1b (also known as jagged3 or serrateA), AY221106; jagged2a (also known as jagged2 or serrateB), AF090432; pendrin1, BC054604; pendrin2, BC054629; ret1, NM_181662; rfx2, BC090314; rhcg, AF398238; slc4a2/ae2, AY876015; vhatpb1, AF472614; and vhatpb1-2, AF472615.