Defined conditions for propagation and manipulation of mouse embryonic stem cells

1Mouse embryonic stem (ES) cells are cell lines derived from the pre-implantation epiblast of mouse embryos. Under appropriate culture conditions they retain the properties of their tissue of origin and can re-enter normal development when introduced into morula- or blastocyst-stage embryos. Moreover, ES cells can readily be genetically modified and clonally expanded. Advances such as genome editing using CRISPR/Cas9 have expanded the opportunities for multiplex and/or complex genome engineering in ES cells. Their properties make ES cells uniquely powerful tools, both for generating genetically modified mice, and for experimental dissection of fate choice in pluripotent cells. These attributes depend entirely, however, upon the genetic and phenotypic fidelity of ES cells during propagation.

2ES cells were first derived in 1981 by culturing early mouse embryos in conditions optimised for teratocarcinoma stem cells. The capacity of ES cells to contribute to chimaeras, colonise the germline and engender healthy offspring was demonstrated in 1984, establishing that they are non-transformed and, in all essential aspects, genetically normal. This finding provoked a major effort to introduce targeted genetic modifications into mice by implementing homologous recombination in ES cells. It was not until the 1990s, however, that the technology became relatively routine (for a review, see ). A major reason for the time gap is that ES cell cultures were frequently found to be aneuploid, particularly after clonal selection. This problem gradually diminished as appreciation spread of the relatively fastidious demands of ES cell culture compared with other cell types. In particular, ES cells must be passaged frequently to avoid any overgrowth, which confers advantage to genetically abnormal cells.

3The original culture conditions for ES cells comprised co-culture with a feeder layer of mitotically arrested embryonic fibroblasts and medium containing carefully screened foetal calf serum (FCS). This effective but complex system was simplified with the discovery that a major contribution of feeders is to provide the cytokine leukaemia inhibitory factor (LIF). Addition of LIF increases the robustness of ES cell cultures on feeders and this remains a widely used system. LIF can also support ES cell derivation and propagation without feeders in either serum or bone morphogenetic protein (BMP). In these conditions, however, the cultures are morphologically heterogeneous. Moreover, the cells show fluctuating expression of several transcription factors known to be expressed in the pre-implantation epiblast and downregulated during peri-implantation development. Thus, ES cells in these culture conditions do not correspond to a discrete stage of embryonic pluripotency and the developmental relevance of metastable gene expression remains unclear. In contrast, ES cells appear morphologically and molecularly relatively homogeneous when maintained in defined medium in which the Erk1/2 signalling pathway is blocked and glycogen synthase kinase 3 is partially inhibited. Under this dual inhibition, known as 2i, ES cells exhibit transcriptome similarity to pre-implantation epiblast. Importantly, unlike other conditions, use of 2i (or its predecessor 3i) enables reliable derivation of authentic ES cells from different strains of mice and also from another species, the rat.

4We have proposed that the defined culture system using the highly specific 2i inhibitors corrals ES cells in a stable ‘ground state’. The 2i platform has been widely exploited to study signalling, gene regulation and network control of naive pluripotency, and the transition path from pluripotency to lineage commitment (;;;;;;,;;;;; preprint;;; ). Importantly, male ES cells maintained in 2i can retain a euploid karyotype and germline chimaera competency over multiple passages with similar efficiency to cells cultured in serum. Interestingly, ES cells show lower global DNA methylation in 2i than in serum. Female ES cells are vulnerable to severe hypomethylation and loss of methylation imprints in either 2i or serum, which can reduce their chimaera contribution. Male ES cells on the other hand can retain relatively normal methylation imprints (Fig. 1), although loss of specific differentially methylated regions (DMRs) has also been reported in both serum and 2i cultures. Genetic background may be one component influencing loss of imprinted DMRs. Another important factor may be levels of culture stress or stimulation due to differences in media composition and cell handling between laboratories, even when using apparently similar conditions. As with any cells in vitro, ES cells are inherently liable to acquire genetic and epigenetic adaptations or abnormalities if subjected to untoward selective pressures. Vulnerability to environmental stress may be enhanced in serum-free culture. Consequently, apparently minor variations in media formulation or culture procedures may give rise to discrepant findings. Reports of subpopulations and cell cycle heterogeneity in 2i culture may likewise be influenced by particular culture practices.

5The field could benefit, therefore, from a stringent methodology for ES cell culture. To that end, we detail here standardised media composition and cell handling procedures for robust propagation and genetic manipulation of mouse ES cells using 2i in defined medium.

6The aim of this procedure is to expand undifferentiated cells in 2i or 2i/LIF. The anticipated outcome is actively growing colonies of uniform size that are evenly distributed across the dish, with no signs of differentiation, and that can be passaged by enzymatic dissociation and expanded continuously. Note that in defined medium cells are generally less tolerant to suboptimal media conditions or environmental perturbations than in the presence of serum, serum substitutes such as KnockOut Serum Replacement (KSR), or feeders. This susceptibility may manifest as spontaneous differentiation and/or cell death. Cells should not be kept out of the incubator any longer than necessary or exposed to varying incubator environments.

7Accutase

80.1-0.2% gelatine in PBS or 10 µg/ml laminin in PBS

9Wash medium (DMEM/F12 + BSA; see Table S1)

102i or 2i/LIF [hereafter referred to as 2i (±LIF)] in N2B27 (see Table S1 for media formulation and suggested suppliers)

11Haemocytometer

12Tissue culture treated plates

13Falcon tubes

14Bench centrifuge

15Humidified incubator at 7% CO2 and 37°C

16Coat plates or wells with 0.1-0.2% gelatine in the incubator for a minimum of 15 min.

17Pre-warm necessary volume of 2i (±LIF) or other culture medium, wash medium and Accutase to 37°C. Note: avoid leaving 2i medium or Accutase at 37°C for too long.

18Remove all gelatine from plates or wells and replace with warm medium. Return to the incubator to pre-equilibrate (not necessary but might help survival, especially for ES cells of non-permissive strains, compromised mutants or when plating at low density). Drying the plates is not necessary.

19Aspirate medium gently but completely from cells and add 0.5 ml of Accutase per well. Avoid drying the cells.

20Incubate with Accutase (see Table 1) at room temperature for 4-6 min until colonies decompact and detach. Tap plate to ensure detachment and initial dissociation.

21Add 1 ml of wash buffer and pipette up and down (without touching the bottom of the dish) 10-20 times in order to obtain a single cell suspension. Try to minimise the formation of bubbles. Tip: check under the microscope to ensure single cell suspension.

22Transfer cell/Accutase/wash suspension to a Falcon tube containing 6 ml of wash medium (see Table 1).

23Centrifuge cells at 300 g for 3.5 min.

24Aspirate supernatant with care, removing as much liquid as possible without disturbing the pellet.

25Re-suspend cell pellet by pipetting up and down 10-15 times in 0.5-2 ml of 2i (±LIF) medium, ensuring a single cell suspension is obtained.

26Count number of cells/ml and plate appropriate number of cells (see Table 1). Slide plate back and forth across a flat surface to distribute cells evenly, then place carefully in incubator. Do not disturb for several hours.

27Cell density will have a significant effect on metabolism, cell cycle and differentiation kinetics, amongst other factors. This is, therefore, a key parameter to monitor. We have observed that culture at high density or colony overgrowth can compromise ability to differentiate and that this effect may become irreversible. Overgrowth of cells in FCS/LIF conditions is also associated with impaired capacity of differentiation and karyotypic instability, but in defined conditions ES cells must be passaged at smaller colony sizes than in FCS- or KSR-containing medium. A single period of overgrowth may induce a permanent change, even if undifferentiated morphology is retained. Specifically, even if overgrown cells regain refractile domed morphology after passaging, they may be compromised. Two key parameters should be kept relatively constant: (1) the density at which cells are plated after each split; (2) the frequency with which cultures are split. Representative images of cultures ready to be passaged are shown in Fig. 2.

28The following cell concentrations are routinely used: for maintenance of cells, 1.5-3.0×104 cells/cm2; for most experiments: 1.5×104 cells/cm2 (see below for differentiation). See also Table 1. It is highly recommended to count cell numbers at every split to avoid overgrowing cells and to monitor growth rate (see Fig. 2 for representative images).

29In routine culture, cells should be split every 2-3 days (Fig. 2). Healthy cultures double every 12-14 h. ES cells in 2i have a substantial proportion of cells in G1 phase (Fig. 3). This is in contrast to FCS cultures, in which ∼70% of cells are in S phase. Even if plated at lower/clonal density, colonies should not be allowed to grow for more than 4-5 days before passaging.

30If passaging is delayed beyond 2 days, medium should be renewed on day 3, and any day thereafter.

31The quality of N2B27 must be monitored. Signs of suboptimal N2B27 include flattening of colonies, cells detaching, reduced proliferation rate, or increased cell death.

32ES cells from certain genetic backgrounds (e.g.C57BL/6) require 2i/LIF in order to be stably propagated long term, whereas others, such as 129 strains, can be propagated in 2i alone or in single inhibitor with LIF. LIF invariably increases colony formation after low-density plating. The addition of LIF alters the kinetics of differentiation, however, delaying the process by ∼12 h. Certain mutant cell lines (e.g. those carrying Etv4/5 gene deletions), are sensitive to MEK inhibition and show more robust proliferation in CH/LIF (LIF containing CHIR99021). To convert cells between 2i, CH/LIF and PD/LIF (LIF containing PD0325901), two passages over 4-6 days are sufficient. PD/LIF cells typically show a more flattened morphology than those grown in conditions containing CH. Because culture in 2i/LIF is most robust, cells can be kept in 2i/LIF for routine passaging, and transferred to other conditions (e.g. 2i or PD/LIF) for one or two passages before experimental analyses. The cell densities reported above work well for all medium conditions.

33Cell lines can either be derived in defined conditions (see below) or adapted from conventional FCS/LIF (with or without feeders) conditions. When converting cells from FCS/LIF, we recommend plating cells first in FCS/LIF and changing media to 2i or 2i/LIF after 24 h. Cell death, mainly associated with elimination of differentiating cells, is often observed for the first few days, but stable homogeneous cultures can be established within one or two passages.

34Cells should be routinely maintained without any antibiotics, in keeping with good tissue culture practice. Antibiotics can mask low level microbial infections and may have unknown effects on cell metabolism and gene expression.

35Mycoplasma testing should be carried out frequently and on all newly generated or obtained lines using PCR assays and commercial kits. If mycoplasma is detected, the cultures should be discarded.

36It is important to maintain two types of cell line stock. Primary stocks are the lowest passage cells available [passage (p) 4-8 for embryo-derived cell lines], that have been genotyped, mycoplasma screened, have at least ∼80% diploid cells (40XY or 40XX) and show uniform morphology. These are kept in liquid nitrogen for long-term storage. Secondary stocks are more numerous at slightly higher passage number (p10-15). These stocks can be kept short term at −80°C and are used for routine experiments. Cells should not normally be passaged beyond 30. However, we have generated high contribution chimeras that give germline transmission after multiple passages of mouse ES cells (p30+), embryonic germ cells (p15+), and haploid ES cells (p20+) in 2i/LIF.

37Accutase is routinely used because it is gentler than trypsin, results in a single cell suspension and does not require serum inactivation. TrypLE reagents may also be used, although these occasionally result in incomplete dissociation. Trypsin can be used, but we recommend adding ∼5% FCS to the wash medium (see Table S1) to ensure complete inactivation, or doubling the volume of wash medium, or increasing the BSA concentration.

38Attachment of poorly adherent cells, a feature of some mutants and non-129 strains (e.g. CBA, NOD, DBA, etc.), can be improved by plating onto laminin-coated plates. For this, coat plates with laminin solution (∼10 µg/ml in PBS) for a minimum of 2 h at 37°C, before aspirating the solution and adding the culture medium.

39DMEM/F12 and Neurobasal buffer can be used at 5-10% CO2. We use 7% CO2 for compatibility with FCS cultures maintained in GMEM. In the presence of B27 we have not observed any advantage of low O2 compared with ambient atmosphere.

40The colony-formation assay is a key functional test in ES cell biology. Cultures are dissociated to a single cell suspension and plated at very low (clonal) density, and the number of colonies that form is determined after several days. This assay can be used as a diagnostic tool for media quality control, and experimentally for determining the proportion of undifferentiated cells in a differentiation or reprogramming study or following a genetic/chemical perturbation, or in a modified culture environment. See Fig. 3 for an example.

41Accutase

4210 µg/ml laminin in PBS

43Wash medium

442i/LIF (see Table S1 for media formulation and suggested suppliers)

45FCS+LIF

46Haemocytometer

47Tissue culture treated plates

48Falcon tubes

49Centrifuge

50Humidified incubator at 7% CO2 and 37°C

51Alkaline phosphatase staining kit

52Coat 12-well plates (provide three wells per sample) with laminin (∼10 µg/ml in PBS) for a minimum of 2 h at 37°C. At clonal density, laminin helps colonies remain attached for the duration of the experiment.

53Pre-warm Accutase, wash medium, and culture medium (e.g. 2i/LIF).

54Before starting, aspirate laminin and add 1 ml of 2i/LIF per well. Return plate to the incubator in the meantime to equilibrate medium.

55Aspirate medium from cells and quickly add appropriate volume of Accutase.

56Incubate with 1 volume of Accutase at room temperature (RT) for 4-6 min (1 min after the colonies have detached).

57Add 1 ml of wash medium and pipette up and down 10-20 times in order to obtain a single cell suspension. Tip: check under the microscope to ensure single cell suspension.

58Transfer cell/Accutase/wash suspension to a Falcon tube containing 5 volumes of wash medium.

59Centrifuge cells at 300 g for 3.5 min.

60Aspirate supernatant with care, removing as much liquid as possible without disturbing the pellet.

61Re-suspend cell pellet in 0.5-2 ml of culture medium (e.g. 2i/LIF).

62Count number of cells/ml.

63Plate 400 cells/well in prepared medium. If necessary, carry out two sequential 1:10 dilutions of the cell to improve accuracy, and aim to pipette ∼50 µl of cell suspension per well.

64Slide plate back and forth across a flat surface to distribute cells evenly, then place carefully in incubator.

65After 4-5 days, perform alkaline phosphatase staining according to manufacturer's instructions, let dry, image plate and count the number of colonies.

66The use of 12-well or 6-well plates is advisable. Plate 400 cells in 12-well plate, and 800 in 6-well plates. It is recommended to perform at least three technical replicates per condition as high variability can occur when plating small numbers of cells. Fluorescence-activated cell sorting of cells directly onto plates can also be used to reduce technical variability.

67Colonies can detach easily; therefore, add fixative gently. Leaving cells for >5 days will increase the likelihood of colony detachment.

68We also recommend performing colony-formation assays in parallel FCS/LIF medium and analysing plates by alkaline phosphatase staining on day 3/4. Monitor cultures to make sure colonies do not merge. In FCS/LIF conditions, differentiating cells, which would not survive in 2i/LIF, will persist and contribute to mixed or wholly alkaline phosphatase-negative colonies. This experiment can serve as a control for plating efficiency and differentiation potential. Fig. 4 shows representative images of colony assays in 2i/LIF and FCS/LIF.

69Typically, we expect wild-type cells maintained in 2i or 2i/LIF to have a clonogenic capacity of ∼70-80% when plated in 2i/LIF in optimal media (all alkaline phosphatase positive) with minimal differentiation.

70Examining the kinetics of exit from naïve pluripotency can inform whether a particular perturbation (genetic, chemical or mechanical) accelerates, delays or blocks transition to differentiation (for examples, see;;;;;; ). This system can also be used for genetic screens to identify regulators of pluripotency progression.

71Accutase

720.1-0.2% gelatine in PBS or 10 µg/ml laminin in PBS (for timecourse studies longer than 48 h, laminin coating is recommended for better attachment)

73Wash medium

742i (±LIF) in N2B27

75N2B27 (see Table S1)

76PBS

77Haemocytometer

78Tissue culture treated plates

79Falcon tubes

80Bench centrifuge

81Humidified incubator at 7% CO2 and 37°C

82Coat 24-well plates or wells with 0.1-0.2% gelatine in the incubator for a minimum of 15 min. Allow for two or three wells per condition (technical repeats). Use a separate plate for each time point.

83Pre-warm necessary volume of 2i (±LIF) or other culture medium, wash medium and Accutase to 37°C. Note: avoid leaving 2i medium or Accutase at 37°C for too long.

84Remove gelatine from plates or wells and replace with warm medium. Return to the incubator to pre-equilibrate (not necessary but might help survival, especially for ES cells of non-permissive strains, compromised mutants or when plating at low density).

85Split cells as indicated previously, re-suspend cell pellet in 0.5-2 ml of 2i (±LIF) and count number of cells/ml.

86Plate 30,000 cells per well of a 24-well plate. Slide plate back and forth across flat surface to distribute cells evenly, then place carefully in incubator. Do not disturb for several hours.

87After 12-24 h, aspirate medium from cells and add 0.5-1 ml of sterile PBS. Aspirate PBS and replace with pre-warmed N2B27. Perform media replacement steps gently to avoid detaching cells.

88Analyse cells at the appropriate time points.

89The exact time at which 2i(±LIF) is replaced by N2B27 to initiate exit from naïve pluripotency is flexible. However, it should be kept constant across experiments. Higher density cultures transition more slowly.

90Different downstream tests can be performed to determine the kinetics of transition and different time points can be chosen (for examples, see;; ). Assays include: (1) colony-formation assay (see ‘Colony-formation assay’ section, Fig. 5A), a key functional assay for exit of the ES cell state, which occurs asynchronously across the population, used to indicate what proportion of the population still remains responsive to naïve ES cell conditions; (2) flow cytometry using reporter cell lines (e.g. Rex1::GFPd2, Nanog-GFP, etc.; Fig. 5B,C); (3) RT-qPCR to determine the expression of genes associated with the different stages of pluripotency or differentiation; (4) fixation and immunostaining for proteins associated with ES cells (e.g. Nanog, Klf4, etc.) or transition [Oct6 (Pou3f1), Otx2, etc.] (Fig. 5D).

91It is recommended to analyse multiple time points. Typically, ∼25-36 h after withdrawal of self-renewal conditions offers a time window during which both delayed and accelerated transition can be evaluated, as ∼50% of the wild-type cell population should remain responsive to 2i/LIF and positive for Rex1GFPd2. The exact timing for each experiment will depend on the starting culture condition (e.g. 2i versus 2i/LIF), the batch of N2B27, cell plating density, etc.

92Monolayer neural differentiation is a simple and well-characterised system and, under the right conditions, an efficient one. Therefore, it can be used to determine competence for differentiation and to examine gene expression dynamics.

93Accutase

94∼10 µg/ml laminin in PBS

95Wash medium

962i (±LIF)

97N2B27 (see Table S1)

98Haemocytometer

99Tissue culture treated plates

100Falcon tubes

101Centrifuge

102Humidified incubator at 7% CO2 and 37°C

103Coat plates with laminin (∼10 µg/ml in PBS) overnight (ideally) or for a minimum 2 h at 37°C.

104Aspirate laminin (do not wash) and add appropriate volume of N2B27. Return to the incubator to pre-equilibrate. Note: pre-equilibration is not necessary but it helps survival.

105Split cells, re-suspend in N2B27 and count them.

106Plate directly in N2B27 onto laminin-coated plate at a density of 1.0×104 cells/cm2 or 1.2×104 cells/cm2 for flow-sorted cells. Optional: adding 1 µg/ml laminin directly to N2B27, before plating cells in laminin-coated plates, can help with adhesion.

107Change media to fresh N2B27 on day 2 and every day thereafter.

108Coat plates with laminin (∼10 µg/ml in PBS) overnight at 37°C.Aspirate laminin (do not wash) and add appropriate volume of 2i (+LIF). Return to the incubator to pre-equilibrate. Note: pre-equilibration is not necessary but it helps survival.Split cells as late as possible in the day and plate in 2i or 2i/LIF onto laminin-coated plate at a density of 1.0×104 cells/cm2 or 1.2×104 cells/cm2 for sorted cells. Optional: adding 1 µg/ml laminin directly into N2B27 can help with adhesion.As early as possible on the next day, gently wash cells with PBS before changing the media to N2B27.Change media to fresh N2B27 on day 2 and every day thereafter.

109Coat plates with laminin (∼10 µg/ml in PBS) overnight at 37°C.

110Aspirate laminin (do not wash) and add appropriate volume of 2i (+LIF). Return to the incubator to pre-equilibrate. Note: pre-equilibration is not necessary but it helps survival.

111Split cells as late as possible in the day and plate in 2i or 2i/LIF onto laminin-coated plate at a density of 1.0×104 cells/cm2 or 1.2×104 cells/cm2 for sorted cells. Optional: adding 1 µg/ml laminin directly into N2B27 can help with adhesion.

112As early as possible on the next day, gently wash cells with PBS before changing the media to N2B27.

113Change media to fresh N2B27 on day 2 and every day thereafter.

114Little or no death should be observed until cells become confluent (Fig. 6B). Significant death at day 3 is a sign of poor-quality media (see ‘Batch testing N2B27’ section) or incorrect plating density. Certain lines may require further optimisation of plating density to minimise cell death. ES cells derived from certain strains might show more cell death compared with 129 or mixed strains. When troubleshooting differentiation, we recommend plating cells at three different cell densities (e.g. 0.75×104 cells/cm2, 1.0×104 cells/cm2 and 1.5×104 cells/cm2), monitoring cell death at day 3-4 and quantifying Sox1-positive cells at day 4-5. Efficient conditions typically yield ∼90% Sox1-positive cultures on day 5 with little non-neural differentiation (Fig. 6C).

115The efficiency and timing of differentiation can be assessed by using the Sox1GFP reporter cell line or by measuring the expression of different neural markers such as Sox1 protein by immunofluorescence over time (Fig. 6A,C). When starting from 2i (no LIF) cells, the following changes in transcription factor expression can be anticipated: day 1, predominantly Oct4 (Pou5f1) positive, Sox2 positive, Sox1 negative; day 3, predominantly Sox2 positive (cells should be either Oct4 or Sox1 positive, as their expression is mutually exclusive), 30-50% Sox1GFP-positive cells; day 4-5, mostly Sox1-positive cells and 80-90% Sox1GFP-positive cells. Tuj1 (Tubb3)-positive cells should appear on day ∼6. Differentiation of cells cultured in 2i+LIF will be delayed by ∼1 day.

116Low cell density is essential for efficient differentiation (Fig. 6A). If starting from 2i+LIF or if cells have to be pre-plated before initiating differentiation, there will be more proliferation before exiting pluripotency. Cell density can be lowered to 0.8×104 cells/cm2.

117The quality of N2B27 should be monitored. Batches should be specifically tested for neural differentiation. Certain mouse strains benefit from high insulin N2B27 (see Table S1).

118Failure to change media regularly, or plating cell density higher than 1.2×104 cells/cm2, can result in mixed differentiation (most obviously indicated by cells undergoing spontaneous contractions) and in persistence of undifferentiated ES cells.

119CRISPR/Cas9 allows for fast and efficient targeted mutagenesis of ES cells. As per routine ES cell culture, it is important to avoid overgrowing cells as they might develop phenotypes unrelated to the genetic perturbation. It is advantageous to use clones that go through the targeting process but that have not been edited as control cell lines. Depending on the plasmid used, transfected cells can be selected either using drug selection or by sorting for the expression of GFP.

120Accutase0.1-0.2% gelatineWash mediumFuGenegRNA vectorsFCS (optional)N2B27, 3 µM CHIR99021, LIF (hereafter referred to as CH/LIF; alternatively use 2i/LIF; see Table S1 for media formulation and suggested suppliers)Penicillin and Streptomycin (PenStrep)Puromycin (depending on the strategy)HaemocytometerTissue culture treated 3.5 cm diameter plates or 12-well plates and 96-well plates for single clone pickingFalcon tubesCentrifugeHumidified incubator at 7% CO2 and 37°CCell sorter (depending on the strategy)

121Accutase

1220.1-0.2% gelatine

123Wash medium

124FuGene

125gRNA vectors

126FCS (optional)

127N2B27, 3 µM CHIR99021, LIF (hereafter referred to as CH/LIF; alternatively use 2i/LIF; see Table S1 for media formulation and suggested suppliers)

128Penicillin and Streptomycin (PenStrep)

129Puromycin (depending on the strategy)

130Haemocytometer

131Tissue culture treated 3.5 cm diameter plates or 12-well plates and 96-well plates for single clone picking

132Falcon tubes

133Centrifuge

134Humidified incubator at 7% CO2 and 37°C

135Cell sorter (depending on the strategy)

136Pre-warm CL, wash medium and Accutase at 37°C. Allow FuGene to equilibrate at RT.Coat 3.5 cm diameter, low-edge dish or wells of a 12-well plate with 0.1-0.2% gelatine and place in incubator for a minimum of 15 min.Prepare transfection mixes as follows. Mix A: 250 ng gRNA 1, 250 ng gRNA 2, 200 μl CH/LIF (control: 200 μl CH/LIF); Mix B: 1 μl FuGene, 200 μl CH/LIF (control: 1 μl FuGene, 200 μl CH/LIF).Split cells as previously indicated.Just before counting cells, combine mix A and B to obtain 400 µl transfection reaction. Incubate for 5-15 min at RT (longer incubation might reduce transfection efficiency).Count cells.Aspirate gelatine from wells and plate 300,000 cells in 1.6 ml of CH/LIF.Add 400 µl of transfection reaction to cells and mix.Ensure even distribution of cells by sliding the dish across a flat surface vertically and horizontally.

137Pre-warm CL, wash medium and Accutase at 37°C. Allow FuGene to equilibrate at RT.

138Coat 3.5 cm diameter, low-edge dish or wells of a 12-well plate with 0.1-0.2% gelatine and place in incubator for a minimum of 15 min.

139Prepare transfection mixes as follows. Mix A: 250 ng gRNA 1, 250 ng gRNA 2, 200 μl CH/LIF (control: 200 μl CH/LIF); Mix B: 1 μl FuGene, 200 μl CH/LIF (control: 1 μl FuGene, 200 μl CH/LIF).

140Split cells as previously indicated.

141Just before counting cells, combine mix A and B to obtain 400 µl transfection reaction. Incubate for 5-15 min at RT (longer incubation might reduce transfection efficiency).

142Count cells.

143Aspirate gelatine from wells and plate 300,000 cells in 1.6 ml of CH/LIF.

144Add 400 µl of transfection reaction to cells and mix.

145Ensure even distribution of cells by sliding the dish across a flat surface vertically and horizontally.

146The day after transfection, change media and add CH/LIF+1 µg/ml puromycin.48 h after transfection, change medium to CH/LIF+0.5 µg/ml puromycin for a further 24 h. This should kill all cells in the control plate.72 h after transfection, change medium to CH/LIF+PenStrep.Day 6-8 after transfection, pick clones for expansion. The control plate should be almost completely clear. Colony number per plate ranges from 30 to 100+ depending on the gRNA.

147The day after transfection, change media and add CH/LIF+1 µg/ml puromycin.

14848 h after transfection, change medium to CH/LIF+0.5 µg/ml puromycin for a further 24 h. This should kill all cells in the control plate.

14972 h after transfection, change medium to CH/LIF+PenStrep.

150Day 6-8 after transfection, pick clones for expansion. The control plate should be almost completely clear. Colony number per plate ranges from 30 to 100+ depending on the gRNA.

151The day after transfection, change media and add fresh CH/LIF.48 h after transfection, sort single GFP-positive cells into a 96-well plate in CH/LIF+PenStrep.72 h after transfection, change medium to fresh CH/LIF+PenStrep.

152The day after transfection, change media and add fresh CH/LIF.

15348 h after transfection, sort single GFP-positive cells into a 96-well plate in CH/LIF+PenStrep.

15472 h after transfection, change medium to fresh CH/LIF+PenStrep.

155Design gRNAs and clone into nickase plasmid [pSpCas9n(BB)-2A-Puro (PX462) V2.0; Addgene plasmid #62987]. The distance between the gRNA target sequences should be kept <200 bp for efficient insertion.Different approaches exist for designing targeting vectors. In our hands, homology arms of 1.5 kb for the 3′ end, and 3 kb for the 5′ end work efficiently, but shorter homology arms might be used. Both gRNA target sequences should be absent in the targeting vector sequence to avoid cleavage. The amount of targeting vector should be minimised to avoid random integration.A 6-well plate format should be used with a cell concentration of 1-2×105 cells and a final volume of 1.6 ml before adding transfection reagent.Transfection mixes should be prepared as follows. Mix A: 900 ng gRNA 1, 900 ng gRNA 2, 200 ng targeting vector, 400 μg CH/LIF; Mix B: 6 μl FuGene, 400 μl CH/LIF.

156Design gRNAs and clone into nickase plasmid [pSpCas9n(BB)-2A-Puro (PX462) V2.0; Addgene plasmid #62987]. The distance between the gRNA target sequences should be kept <200 bp for efficient insertion.

157Different approaches exist for designing targeting vectors. In our hands, homology arms of 1.5 kb for the 3′ end, and 3 kb for the 5′ end work efficiently, but shorter homology arms might be used. Both gRNA target sequences should be absent in the targeting vector sequence to avoid cleavage. The amount of targeting vector should be minimised to avoid random integration.

158A 6-well plate format should be used with a cell concentration of 1-2×105 cells and a final volume of 1.6 ml before adding transfection reagent.

159Transfection mixes should be prepared as follows. Mix A: 900 ng gRNA 1, 900 ng gRNA 2, 200 ng targeting vector, 400 μg CH/LIF; Mix B: 6 μl FuGene, 400 μl CH/LIF.

160Typically, 12-24 clones are picked per transfection and this is sufficient to obtain at least two targeted lines. Coat wells of a 96-well plate (plate 1) with 0.1-0.2% gelatine in the incubator for a minimum of 15 min.Pre-warm CH/LIF+PenStrep and Accutase.Add 15 µl of PBS to the bottom of each well of a new 96-well plate (plate 2).Under an inverted or dissection microscope in a flow cabinet, pick individual colonies and deposit in a well of plate 2 (containing PBS). If picking 36+ colonies, it is recommended to pick them in smaller batches. Do not leave colonies in PBS for more than 15-20 min. Pick colonies of different sizes. Change pipette tips between picks.Add 30 µl of Accutase to each well of plate 2 and incubate for ∼5-10 min shaking occasionally.Add 150 µl of CH/LIF+PenStrep to each well of plate 2 (containing the picked clones) and pipette up and down to separate colonies into single cells.Aspirate gelatine from plate 1 (previously prepared).Transfer all the cell suspension from plate 2 onto plate 1. Evenly disperse cells by sliding plate vertically and horizontally across a flat surface.Next day, gently change media to fresh CH/LIF+PenStrep by aspirating most of the media, leaving just enough to cover cells. Take care not to detach cells.

161Coat wells of a 96-well plate (plate 1) with 0.1-0.2% gelatine in the incubator for a minimum of 15 min.

162Pre-warm CH/LIF+PenStrep and Accutase.

163Add 15 µl of PBS to the bottom of each well of a new 96-well plate (plate 2).

164Under an inverted or dissection microscope in a flow cabinet, pick individual colonies and deposit in a well of plate 2 (containing PBS). If picking 36+ colonies, it is recommended to pick them in smaller batches. Do not leave colonies in PBS for more than 15-20 min. Pick colonies of different sizes. Change pipette tips between picks.

165Add 30 µl of Accutase to each well of plate 2 and incubate for ∼5-10 min shaking occasionally.

166Add 150 µl of CH/LIF+PenStrep to each well of plate 2 (containing the picked clones) and pipette up and down to separate colonies into single cells.

167Aspirate gelatine from plate 1 (previously prepared).

168Transfer all the cell suspension from plate 2 onto plate 1. Evenly disperse cells by sliding plate vertically and horizontally across a flat surface.

169Next day, gently change media to fresh CH/LIF+PenStrep by aspirating most of the media, leaving just enough to cover cells. Take care not to detach cells.

170Coat a sufficient number of wells in a 48-well plate with 0.1-0.2% gelatine solution for at least 15 min at 37°C.Warm Accutase and CL+PenStrep at 37°C.Aspirate gelatine from wells of the 48-well plate and add 200 µl of CH/LIF+PenStrep. Return plate to the incubator to pre-equilibrate.Aspirate media from 96-well plates (plate 1, containing primary clones) and add 50 µl of Accutase. Incubate for ∼6 min until all the colonies have detached from the plate.Add 100 µl of CH/LIF+PenStrep and pipette up and down to obtain single cell suspension.Transfer 100 µl of cell suspension to the pre-equilibrated 48-well plate. Ensure uniform distribution of cells before placing in the incubator.Optional: The remaining cell suspension in the 96-well plate can be used for genotyping. Add 150 µl of CH/LIF+PenStrep+1% FCS to each well of the original 96-well plate. Cells can be harvested on day 2 for genomic DNA or mRNA purification and genotyping.

171Coat a sufficient number of wells in a 48-well plate with 0.1-0.2% gelatine solution for at least 15 min at 37°C.

172Warm Accutase and CL+PenStrep at 37°C.

173Aspirate gelatine from wells of the 48-well plate and add 200 µl of CH/LIF+PenStrep. Return plate to the incubator to pre-equilibrate.

174Aspirate media from 96-well plates (plate 1, containing primary clones) and add 50 µl of Accutase. Incubate for ∼6 min until all the colonies have detached from the plate.

175Add 100 µl of CH/LIF+PenStrep and pipette up and down to obtain single cell suspension.

176Transfer 100 µl of cell suspension to the pre-equilibrated 48-well plate. Ensure uniform distribution of cells before placing in the incubator.

177Optional: The remaining cell suspension in the 96-well plate can be used for genotyping. Add 150 µl of CH/LIF+PenStrep+1% FCS to each well of the original 96-well plate. Cells can be harvested on day 2 for genomic DNA or mRNA purification and genotyping.

178This protocol employs SpCas9(BB)-2A-Puro (PX459) (Addgene plasmid #62988) or pSpCas9(BB)-2A-GFP (PX458) (Addgene plasmid #48138).

179Set up transfections late in the day in order to be able to change media within ∼16 h post-transfection.

180Each transfection will require 300,000 cells per well (round dish with 3.5 cm diameter and a low edge to facilitate colony picking). Include one extra well as a control.

181Transfections in N2B27/CHIR99021/LIF (CH/LIF) result in better attachment and improved survival during selection when targeting some genes but in general 2i/LIF is effective. The addition of 1% FCS can help cell adhesion, especially after picking clones, but it is not necessary for most lines.

182For efficient knockout, we routinely use two gRNA constructs per gene and FuGene HD transfection reagent (Promega, E2311). Two genes can be targeted at the same time by transfecting four gRNA constructs. In such cases, the amount of FuGene HD can be doubled.

183Include a well containing only FuGene and no gRNA as a control for drug selection or cell sorting.

184Do not let primary colonies overgrow as this will increase the chances of cell lines becoming compromised.

185Efficient transfection of siRNA for knockdown of single or multiple genes in cells grown in serum-free conditions.

186AccutaseWash medium2i (±LIF) (see Table S1 for media formulation and suggested suppliers)0.1-0.2% gelatine in PBS or ∼10 µg/ml laminin in PBSHaemocytometerTissue culture treated 24-well platesCentrifugeHumidified incubator at 7% CO2 and 37°C

187Accutase

188Wash medium

1892i (±LIF) (see Table S1 for media formulation and suggested suppliers)

1900.1-0.2% gelatine in PBS or ∼10 µg/ml laminin in PBS

191Haemocytometer

192Tissue culture treated 24-well plates

193Centrifuge

194Humidified incubator at 7% CO2 and 37°C

195Dissolve Qiagen FlexiTube siRNAs in 50 μl RNAase-free water to obtain a 20 μM stock solution.Mix equal volumes of each siRNA to obtain a 20 μM pool siRNA solution (each siRNA at 5 μM).Keep on ice throughout.

196Dissolve Qiagen FlexiTube siRNAs in 50 μl RNAase-free water to obtain a 20 μM stock solution.

197Mix equal volumes of each siRNA to obtain a 20 μM pool siRNA solution (each siRNA at 5 μM).

198Keep on ice throughout.

199Set up late afternoon. Coat a sufficient number of wells in 24-well plates with gelatine solution for at least 15 min at 37°C. If carrying out neural differentiation after siRNA transfection, laminin coating is recommended instead.Incubate 0.5 μl pooled siRNAs in 50 µl of 2i and 0.5 μl Lipofectamine RNAiMAX (Life Technologies, 13778075) in 50 μl of 2i medium. After 2-3 min, mix and incubate for 20 min at RT (while splitting the cells).Split cells and dilute to give 3.0×104 cells in 400 µl of 2i for each well.Aspirate gelatine from 24-well plate and combine 100 µl of siRNA solution with 400 µl of cell suspension per well.Incubate overnight.Next morning, wash gently with PBS and change medium and/or collect cells for RT-qPCR to determine knockdown efficiency. Note: differentiation can be initiated at this point by changing medium to N2B27.

200Coat a sufficient number of wells in 24-well plates with gelatine solution for at least 15 min at 37°C. If carrying out neural differentiation after siRNA transfection, laminin coating is recommended instead.

201Incubate 0.5 μl pooled siRNAs in 50 µl of 2i and 0.5 μl Lipofectamine RNAiMAX (Life Technologies, 13778075) in 50 μl of 2i medium. After 2-3 min, mix and incubate for 20 min at RT (while splitting the cells).

202Split cells and dilute to give 3.0×104 cells in 400 µl of 2i for each well.

203Aspirate gelatine from 24-well plate and combine 100 µl of siRNA solution with 400 µl of cell suspension per well.

204Incubate overnight.

205Next morning, wash gently with PBS and change medium and/or collect cells for RT-qPCR to determine knockdown efficiency. Note: differentiation can be initiated at this point by changing medium to N2B27.

206Transfect Rex1::GFPd2 cells with control or GFP siRNA and analyse by flow cytometry after overnight incubation. An acceptable transfection efficiency is >90% (Fig. 7). Note that this control is sensitive because GFPd2 protein is destabilised with a half-life of ∼2 h.

207PenStrep- or serum-containing media cannot be used as this inhibits transfection.

208Use the same media to prepare the transfection mix and culture cells (best results in 2i, without LIF).

209Do not leave the cells in the transfection media for more than ∼16 h or they will die.

210Cells must be actively replicating; using confluent cells (large colonies) will decrease the transfection efficiency.

211Control siRNAs are as follows: GFP (custom-made), GCAAGCUGACCUGAAGUUCA; control (AllStars negative control siRNA, Qiagen, SI03650318).

212Derivation of ES cell lines from individual embryos, in serum-free conditions.

213KSOM medium (Millipore, MR-106-D) or Blast (Origio, 83060010)M2 medium (Millipore MR-015-D)2i/LIF medium in N2B27 (see Table S1)2i/LIF in M2Tyrode's solution, acidic (Sigma-Aldrich T1788 or Millipore MR-004-D)Rabbit anti-mouse antiserum (Sigma-Aldrich, M5774)Complement sera from guinea pig, lyophilised [Calbiochem (Merck) 234395] or rat serum (as a source of complement, made in-house, not heat inactivated, kept at −80°C)∼10 µg/ml laminin in PBSAccutaseDissecting microscopeLaminar flow hoodHumidified incubator at 7% CO2 and 37°CMouth pipettePasteur pipettesOrgan culture dishesTissue culture plastics

214KSOM medium (Millipore, MR-106-D) or Blast (Origio, 83060010)

215M2 medium (Millipore MR-015-D)

2162i/LIF medium in N2B27 (see Table S1)

2172i/LIF in M2

218Tyrode's solution, acidic (Sigma-Aldrich T1788 or Millipore MR-004-D)

219Rabbit anti-mouse antiserum (Sigma-Aldrich, M5774)

220Complement sera from guinea pig, lyophilised [Calbiochem (Merck) 234395] or rat serum (as a source of complement, made in-house, not heat inactivated, kept at −80°C)

221∼10 µg/ml laminin in PBS

222Accutase

223Dissecting microscope

224Laminar flow hood

225Humidified incubator at 7% CO2 and 37°C

226Mouth pipette

227Pasteur pipettes

228Organ culture dishes

229Tissue culture plastics

230Pre-equilibrate organ culture dishes containing KSOM (or Blast) +1 µM PDO325901 and 3 µM CHIR99021 (2i/KSOM) in the incubator for at least 15 min. Put PBS in the outer well to prevent evaporation. Flush embryos from oviducts using M2 medium at the 8-cell stage (Fig. 8A) and place into pre-equilibrated 2i/KSOM for 1-2 days until embryos reach the blastocyst stage (Fig. 8B). Note: Blast media (Origio) can be used as an alternative, but N2B27 is not suitable until after blastocyst cavitation.Prepare and pre-equilibrate a fresh organ culture dish containing 2i/LIF in N2B27 (LIF improves success rate, but is not essential) in the central well and PBS in the outer well.Transfer embryos (now at blastocyst stage) to the new dish.Incubate for 1 or 2 more days, depending on when the embryos were transferred to N2B27. A total of 3 days in culture is optimal (Fig. 8C).On day 3 of culture, pre-equilibrate an organ culture dish containing N2B27+20% anti-mouse serum and three dishes containing 400 µl N2B27 in the incubator. Also, gelatinise a 96-well plate. After 20 min, aspirate gelatine and add 200 µl 2i/LIF in N2B27. Leave in the incubator to pre-equilibrate.If the embryos have not hatched, remove the zona pellucida by use of acid Tyrode's solution (Fig. 8D).Place a drop (∼300 µl) of Tyrode's solution on a sterile flat dish.Transfer embryos still contained within the zona pellucida to Tyrode's solution with minimal carry over and monitor under a dissection microscope until the zona has been dissolved.Once the zona is dissolved, wash embryos in one of the dishes of N2B27.Place embryos in a pre-equilibrated dish containing N2B27+20% anti-mouse serum.Incubate for 30 min to an hour or so in the incubator.Rinse three times in pre-equilibrated N2B27 (or M2, if preferred) by transferring embryos through drops.Add 100 µl of freshly thawed rat serum or guinea pig complement to pre-equilibrated 400 µl N2B27 to obtain a 20% solution (Fig. 8E,F). Incubate embryos in complement for ∼30 min until the trophectoderm begins to lyse (Fig. 8E). Use a Pasteur pipette of the approximate size of the inner cell mass (ICM) to remove it from the lysing trophectoderm (Fig. 8F).Note: it is essential that the time between thawing and use is kept to a minimum because the complement is highly unstable.Place each isolated ICM into a well of the 96-well plate with pre-equilibrated 2i/LIF in N2B27.Incubate for 3-7 days, during which time each ICM will form an ES-like colony (Fig. 8G).To passage primary outgrowths, gently aspirate media from wells, add 50µl Accutase per well of 96-well plate and incubate for ∼5 min until primary colonies detach. Add 100µl of 2i/LIF, pipette up and down to obtain single cell suspension, and transfer all content to a new laminin-coated well of a 96-well plate. Next day, change medium to fresh 2i/LIF. Repeat passaging procedure, progressively expanding the line to 48-well, 24-well, etc. At the 24-well stage, passage lines as indicated in ‘Propagation of ES cells without serum factors or feeders’ section.

231Pre-equilibrate organ culture dishes containing KSOM (or Blast) +1 µM PDO325901 and 3 µM CHIR99021 (2i/KSOM) in the incubator for at least 15 min. Put PBS in the outer well to prevent evaporation. Flush embryos from oviducts using M2 medium at the 8-cell stage (Fig. 8A) and place into pre-equilibrated 2i/KSOM for 1-2 days until embryos reach the blastocyst stage (Fig. 8B). Note: Blast media (Origio) can be used as an alternative, but N2B27 is not suitable until after blastocyst cavitation.

232Prepare and pre-equilibrate a fresh organ culture dish containing 2i/LIF in N2B27 (LIF improves success rate, but is not essential) in the central well and PBS in the outer well.

233Transfer embryos (now at blastocyst stage) to the new dish.

234Incubate for 1 or 2 more days, depending on when the embryos were transferred to N2B27. A total of 3 days in culture is optimal (Fig. 8C).

235On day 3 of culture, pre-equilibrate an organ culture dish containing N2B27+20% anti-mouse serum and three dishes containing 400 µl N2B27 in the incubator. Also, gelatinise a 96-well plate. After 20 min, aspirate gelatine and add 200 µl 2i/LIF in N2B27. Leave in the incubator to pre-equilibrate.

236If the embryos have not hatched, remove the zona pellucida by use of acid Tyrode's solution (Fig. 8D).

237Place a drop (∼300 µl) of Tyrode's solution on a sterile flat dish.

238Transfer embryos still contained within the zona pellucida to Tyrode's solution with minimal carry over and monitor under a dissection microscope until the zona has been dissolved.

239Once the zona is dissolved, wash embryos in one of the dishes of N2B27.

240Place embryos in a pre-equilibrated dish containing N2B27+20% anti-mouse serum.

241Incubate for 30 min to an hour or so in the incubator.

242Rinse three times in pre-equilibrated N2B27 (or M2, if preferred) by transferring embryos through drops.

243Add 100 µl of freshly thawed rat serum or guinea pig complement to pre-equilibrated 400 µl N2B27 to obtain a 20% solution (Fig. 8E,F). Incubate embryos in complement for ∼30 min until the trophectoderm begins to lyse (Fig. 8E). Use a Pasteur pipette of the approximate size of the inner cell mass (ICM) to remove it from the lysing trophectoderm (Fig. 8F).

244Note: it is essential that the time between thawing and use is kept to a minimum because the complement is highly unstable.

245Place each isolated ICM into a well of the 96-well plate with pre-equilibrated 2i/LIF in N2B27.

246Incubate for 3-7 days, during which time each ICM will form an ES-like colony (Fig. 8G).

247To passage primary outgrowths, gently aspirate media from wells, add 50µl Accutase per well of 96-well plate and incubate for ∼5 min until primary colonies detach. Add 100µl of 2i/LIF, pipette up and down to obtain single cell suspension, and transfer all content to a new laminin-coated well of a 96-well plate. Next day, change medium to fresh 2i/LIF. Repeat passaging procedure, progressively expanding the line to 48-well, 24-well, etc. At the 24-well stage, passage lines as indicated in ‘Propagation of ES cells without serum factors or feeders’ section.

248Three main tests are carried out on batches of N2B27 to determine suitability for cell culture:

249See ‘Colony-formation assay’ section for a detailed protocol. Culture cells in batches of 2i/LIF in N2B27 side-by-side for two or three passages.For testing, coat a 12-well plate with laminin (∼10 µg/ml in PBS), three wells per batch.Plate 400 cells/well in 2i/LIF+batch N2B27.After 5 days, perform alkaline phosphatase staining according to manufacturer's instructions and count the number of colonies.Good batches result in >80% clonogenicity.

250Culture cells in batches of 2i/LIF in N2B27 side-by-side for two or three passages.

251For testing, coat a 12-well plate with laminin (∼10 µg/ml in PBS), three wells per batch.

252Plate 400 cells/well in 2i/LIF+batch N2B27.

253After 5 days, perform alkaline phosphatase staining according to manufacturer's instructions and count the number of colonies.

254Good batches result in >80% clonogenicity.

255Culture Rex1::GFPd2 cells for two or three passages in 2i batch-N2B27.Analyse by flow cytometry.Good batches result in log-normal distributions.Note: Other cell lines can be used but if the reporter protein is not destabilised (i.e. has a long half-life) cells have to be cultured for longer periods. If reporter cells are not available, immunostaining for Nanog can also be performed. Good batches result in relatively uniform Nanog expression across all cells.

256Culture Rex1::GFPd2 cells for two or three passages in 2i batch-N2B27.

257Analyse by flow cytometry.

258Good batches result in log-normal distributions.

259Note: Other cell lines can be used but if the reporter protein is not destabilised (i.e. has a long half-life) cells have to be cultured for longer periods. If reporter cells are not available, immunostaining for Nanog can also be performed. Good batches result in relatively uniform Nanog expression across all cells.

260Although most batches will enable self-renewal of ES cells, differentiation requires specific attention. Follow neural differentiation protocol above and examine cells on day 3-4.Good batches of N2B27 show little cell death until cells reach confluence. Death on day 2-3 is evident in poor batches.

261Follow neural differentiation protocol above and examine cells on day 3-4.

262Good batches of N2B27 show little cell death until cells reach confluence. Death on day 2-3 is evident in poor batches.

263Some useful troubleshooting tips are presented in Table 2.

264In this paper, we have aimed to provide an accessible and comprehensive set of step-by-step protocols, including all media formulations, to facilitate robust and standardised manipulation of mouse ES cells in defined conditions. We provide guidelines for quality control and troubleshooting tips. The indicated reporter cell lines for calibration are available from the authors. We highlight key parameters that may perturb ES cell behaviour and genetic integrity. In particular, we emphasise the requirement for timely passaging to avoid overgrowth of colonies. Feedback on these protocols and recommendations for further improvement are welcome.