An N-terminal motif in NLR immune receptors is functionally conserved across distantly related plant species

1Plants have evolved intracellular immune receptors to detect host-translocated pathogen virulence proteins, known as effectors. These receptors, encoded by disease resistance (R) genes, are primarily nucleotide-binding, leucine-rich repeat proteins (NLRs). NLR-triggered immunity (also known as effector-triggered immunity) includes the hypersensitive response (HR), a type of programmed cell death associated with disease resistance. NLRs are widespread across eukaryotes and have been described in animals and fungi in addition to plants. In contrast to other taxa, plants express very large and diverse repertoires of NLRs, with anywhere from about 50 to 1000 genes encoded per genome. Genome-wide analyses have defined repertoires of NLRs (NLRome) across plant species. An emerging paradigm is that plant NLRs form receptor networks with varying degrees of complexity. NLRs have probably evolved from multifunctional singleton receptors—which combine pathogen detection (sensor activity) and immune signalling (helper or executor activity) into a single protein—to functionally specialized interconnected receptor pairs and networks. However, our knowledge of the functional connections and biochemical mechanisms underpinning plant NLR networks remains limited. In addition, although dozens of NLR proteins have been subject to functional studies since their discovery in the 1990 s, this body of knowledge has not been interpreted through an evolutionary biology framework that combines molecular mechanisms with phylogenetics.

2NLRs are multidomain proteins of the ancient group of Signal Transduction ATPases (STAND) proteins that share a nucleotide-binding (NB) domain. In addition to the NB and LRR domains, most plant NLRs have characteristic N-terminal domains that define three subgroups: coiled-coil (CC), CCR or RPW8-like (RPW8) and toll and interleukin-1 receptor (TIR). In metazoans, NLRs confer immunity to diverse pathogens through a wheel-like oligomerization process resulting in multiprotein platforms that recruit downstream elements, such as caspases. Plant NLRs have long been thought to oligomerize through their N-terminal domains when they’re activated. However, the precise molecular mechanisms that underpin NLR activation and subsequent execution of HR cell death have remained largely unknown until very recently. In two remarkable papers, and have significantly advanced our understanding of both the structural and biochemical basis of CC-NLR activation in plants. They reconstituted the inactive and active complexes of the Arabidopsis CC-NLR ZAR1 (HOPZ-ACTIVATED RESISTANCE1) with its partner receptor-like cytoplasmic kinases (RLCKs). Cryo-electron microscopy (cryo-EM) structures revealed that activated ZAR1 forms a resistosome—a wheel-like pentamer that undergoes a conformational switch to expose a funnel-shaped structure formed by the N-terminal α helices (α1) of the CC domains. They propose an engaging model in which the exposed α1 helices of the ZAR1 resistosome mediate cell death by translocating into the plasma membrane and perturbing membrane integrity similar to pore-forming toxins. However, whether the ZAR1 model extends to other CC-NLRs is unknown. One important unanswered question is the extent to which the α1 helix ‘death switch’ occurs in other CC-NLRs.

3Although ZAR1 is classified as a singleton NLR that detects pathogen effectors without associating with other NLRs, many plant NLRs are interconnected in NLR pairs or networks. Paired and networked NLRs consist of sensor NLRs that detect pathogen effectors and helper NLRs that translate this effector recognition into HR cell death and immunity. In the Solanaceae, a major phylogenetic clade of CC-NLRs forms a complex immunoreceptor network in which multiple helper NLRs, known as NLR-REQUIRED FOR CELL DEATH (NRC), are required by a large number of sensor NLRs, encoded by R gene loci, to confer resistance against diverse pathogens, such as viruses, bacteria, oomycetes, nematodes and insects. These proteins form the NRC superclade, a well-supported phylogenetic cluster divided into the NRC helper clade (NRC-helpers or NRC-H) and a larger clade that includes all known NRC-dependent sensor NLRs (NRC-sensors or NRC-S). The NRC superclade has expanded over 100 million years ago (Mya) from an NLR pair that diversified to up to one-half of the NLRs of asterid plants. How this diversification has impacted the biochemical activities of the NRC-S compared to their NRC-H mates is poorly understood. For example, it’s unclear how the ZAR1 conceptual framework applies to more complex NLR configurations such as the NRC network.

4This paper originates from use of the in vitro Mu transposition system to generate a random truncation library and identify the minimal region required for CC-NLR-mediated cell death. We applied this method to NRC4—a CC-NLR helper of the NRC family that is genetically required by a multitude of NRC-S, such as the potato late blight resistance protein Rpi-blb2, to cause HR cell death and confer disease resistance. This screen revealed that the N-terminal 29 amino acids of NRC4 are sufficient to induce cell death. Remarkably, this region is about 50% identical to the N-terminal ZAR1 α1 helix, which undergoes the conformational ‘death switch’ associated with the activation of the ZAR1 resistosome. Computational analyses revealed that this region is defined by a motif, following the consensus MADAxVSFxVxKLxxLLxxEx, which we coined the ‘MADA motif’. This sequence is conserved not only in NRC4 and ZAR1 but also in ~20% of all CC-NLRs of dicot and monocot species. Motif swapping experiments revealed that the MADA motif is functionally conserved between NRC4 and ZAR1, as well as between NLRs from distantly related plant species. Interestingly, NRC-S lack N-terminal MADA sequences, which may have become non-functional over evolutionary time. We conclude that the evolutionarily constrained MADA motif is critical for the cell death inducing activity of CC domains from a significant fraction of plant NLR proteins, and that the ‘death switch’ mechanism defined for the ZAR1 resistosome is probably widely conserved across singleton and helper CC-NLRs.

5The N-terminal CC domain of a subset of CC-NLR proteins can mediate self-association and trigger HR cell death when expressed on its own. However, to date truncation experiments have been conducted based on educated guesses of domain boundaries. Moreover, one amino acid difference in the length of the assayed truncation can affect cell death inducing activity. Therefore, we designed an unbiased truncation approach using bacteriophage Mu in vitro transposition system to randomly generate a C-terminal deletion library of the helper NLR NRC4. By using a custom-designed artificial transposon (Mu-STOP transposon) that carries staggered translation stop signals at Mu R-end, we targeted the full-length coding sequence of the NRC4 autoactive mutant, NRC4D478V, (referred to from here on as NRC4DV). We generated a total of 65 truncated NRC4DV::Mu-STOP variants and expressed these mutants in Nicotiana benthamiana leaves using agroinfiltration (Figure 1A). Remarkably, only a single truncate carrying the N-terminal 29 amino acids triggered visible cell death in N. benthamiana leaves (Figure 1B, Figure 1—figure supplement 1). To validate this phenotype, we expressed NRC4 N-terminal 29 amino acids (NRC41-29) fused with the yellow fluorescent protein (YFP) at the C-terminus in N. benthamiana leaves (Figure 2A). NRC41-29-YFP triggered a visible cell death response, although the cell death intensity was weaker than that of the full-length NRC4DV-YFP (Figure 2B–E).

6To determine whether NRC41-29-YFP requires the endogenous N. benthamiana NRC4 to trigger cell death, we expressed this fusion protein in two independent mutant nrc4a/b plants that carry CRISPR/Cas9-induced mutations in the two NRC4 genes NRC4a and NRC4b (Figure 2—figure supplement 1, see Materials and methods). In these plants, NRC41-29-YFP still induced cell death indicating that the activity of the N-terminal 29 amino acids of NRC4 is independent of a full-length NRC4 protein (Figure 2C–D and F–G).

7The CC domains of ZAR1 and maize Rp1 (RESISTANCE to PUCCINIA 1) are autoactive when expressed as a fusion protein with a fluorescent protein tag. Given that YFP and related fluorescent proteins self-oligomerize, we hypothesized that such fluorescent proteins promote self-assembly of the N-terminal 29 amino acids of NRC4 resulting in hypersensitive cell death. To test this hypothesis, we modified YFP with the alanine 206 (A206) to lysine (K) mutation that reduces homo-affinity (Figure 2—figure supplement 2A). The YFPA206K mutation compromised the cell death intensity of NRC41-29-YFP but not that of full-length NRC4DV (Figure 2—figure supplement 2B–E). This result indicates that YFP-mediated self-assembly is a key step in the capacity of NRC41-29-YFP to trigger hypersensitive cell death.

8Our finding that the N-terminal 29 amino acids of NRC4 are sufficient to trigger cell death prompted us to investigate the occurrence of this sequence across the plant NLRome. We first compiled a sequence database containing 988 putative CC-NLRs and CCR-NLRs (referred to from here on as CC-NLR database, Figure 3A, Figure 3—figure supplement 1) from six representative plant species (Arabidopsis, sugar beet, tomato, N. benthamiana, rice and barley) amended with 23 functionally characterized NLRs. Next, we extracted their sequences prior to the NB-ARC domain (Figure 3A). These sequences were too diverse and aligned poorly to each other to enable global phylogenetic analyses. Therefore, to classify the extracted N-terminal sequences based on sequence similarity, we clustered them into protein families using Markov cluster (MCL) algorithm Tribe-MCL (Figure 3A). The 988 proteins clustered into 59 families of at least two sequences (tribes) and 43 singletons (Figure 3B). The largest tribe, Tribe 1, consists of 219 monocot NLRs, including MLA10, Sr33, Sr50, the paired Pik and Pia (RGA4 and RGA5) NLRs, and seven dicot NLRs notably RPM1 (Figure 3B). Tribe 2, the second largest tribe with 102 proteins, consists primarily of dicot proteins (93 out of 102) but still includes nine monocot NLRs. Interestingly, Tribe 2 grouped NRC-H proteins, including NRC4, with well-known CC-NLRs, such as ZAR1, RPP13, R2 and Rpi-vnt1.3 indicating that these proteins share similarities in their CC domains (Figure 3B).

9We performed phylogenetic analyses of NLR proteins using the NB-ARC domain because it is the only conserved domain that produces reasonably good global alignments and can inform evolutionary relationships between all members of this family (Figure 3—figure supplement 2). We mapped individual NLR proteins grouped in Tribe-MCL N-terminal tribes onto a phylogenetic tree based on the NB-ARC domain (Figure 3C). These analyses revealed that the clustering of NLRs into the N-terminal tribes does not always match the NB-ARC phylogenetic clades (Figure 3C). In particular, NLRs in Tribe 1 and Tribe 2 often mapped to distinct well-supported clades scattered throughout the NB-ARC phylogenetic tree. We conclude that there are N-terminal domain sequences that have remained conserved over evolutionary time across distantly related CC-NLRs.

10Next, we investigated whether N-terminal domains of CC-NLRs carry specific sequence motifs. We used MEME (Multiple EM for Motif Elicitation) to identify conserved patterns in each of the N-terminal domain tribes. MEME revealed several conserved sequence patterns in each of the four largest tribes (Figure 4—figure supplement 1). The previously reported sequence pattern, EDVID motif, was as expected predicted in ~87% to 96% in the four largest tribes (Figure 4—figure supplement 1). Within Tribe 2, a motif that is conserved at the N terminus of 87 of 102 proteins overlapped with the N-terminal 29 amino acids of NRC4 we identified as sufficient to cause cell death (Figure 4—figure supplement 1). Remarkably, the conserved sequence pattern of this very N-terminal motif matched the ZAR1 α1 helix that undergoes a conformational switch during activation of the ZAR1 resistosome (Figure 4A–B). In fact, 8 of the first 17 amino acids of ZAR1 are invariant in NRC4, and the majority of the amino acid polymorphisms between ZAR1 and NRC4 in the α1 helix region are conservative (Figure 4A). We conclude that NRC4, ZAR1 and numerous other CC-NLRs share a conserved N-terminal motif. We coined this sequence ‘MADA motif’ based on the deduced 21 amino acid consensus sequence MADAxVSFxVxKLxxLLxxEx (Figure 4A, Figure 4—figure supplement 2).

11We built a Hidden Markov Model (HMM) from a sequence alignment of the MADA motif of 87 NLR proteins from Tribe 2. To determine whether the MADA motif is primarily found among proteins annotated as NLRs, we used the HMMER software to query the Arabidopsis and tomato proteomes using the MADA motif HMM. HMMER searches revealed that the MADA motif is mainly found in NLR proteins compared with non-NLR proteins (Figure 4C). An HMM score cut-off of 10.0 clearly distinguishes NLR proteins from others with 97.1% (34 out of 35) tomato proteins and 97.7% (42 out of 43) Arabidopsis proteins scoring over 10.0 being annotated as NLRs (Figure 4C). We conclude that the MADA motif is a sequence signature of a subset of NLR proteins and that a HMMER cut-off score of 10.0 is most optimal for high confidence searches of MADA containing CC-NLR proteins (MADA-CC-NLRs).

12To what extent does the MADA motif occur in plant NLRomes? We re-screened the CC-NLR database using HMMER and identified 103 hits (10.4%) over the cut-off score of 10.0 (Figure 5A–B, Figure 5—figure supplement 1A). We also noted that another 129 NLRs were positive but with a score lower than 10.0, and we tentatively termed these hits as MADA-like CC-NLRs (MADAL-CC-NLRs) (Figure 5B, Figure 5—figure supplement 1A). Most of the MADA hits are from dicot plant species whereas MADAL-CC-NLRs are primarily from monocots possibly reflecting a bias in our HMM profile which was built from the dicot enriched Tribe 2 (Figure 5C, Figure 5—figure supplement 1B). Indeed, the majority of MADA hits (85 out of 103) were from Tribe 2, which includes NRC4 and ZAR1, but some MADA hits were also from other Tribes, notably the rice helper NLR Pik-2 from Tribe 1 (HMM score = 10.4) (Figure 5C, Figure 5—figure supplement 1C). MADAL-CC-NLRs are mainly from Tribe 1 and Tribe 4 and include the monocot proteins MLA10 and Sr33, as well as Arabidopsis RPM1 (Figure 5C, Figure 5—figure supplement 1C).

13Given that the MADA sequence is at the very N-terminus of ZAR1 and NRC4, and that the N-terminal position of the ZAR1 α1 helix is critical for its function based on the model of, we checked the positional distribution of predicted MADA and MADAL motifs (Figure 5D). The majority of the predicted MADA and MADAL motifs (199 out of 232, 85.8%) occurred at the very beginning of the NLR protein. However, 4 of 103 of the predicted MADA- and 29 of 129 MADAL-CC-NLRs have N-terminal extensions over 15 amino acids prior to the motifs (Figure 5D). For example, the MADA motif is located at position 54 to 72 amino acids in the potato NLR Rpi-vnt1.3. Whether these exceptions reflect misannotated gene models or genuinely distinct motif sequences remains to be determined.

14In summary, our bioinformatic analyses revealed that 199 out 988 (20.1%) of the CC-NLRs of six representative dicot and monocot species contain a MADA or MADAL motif at their very N-termini. These MADA sequences have noticeable similarity to NRC4 and ZAR1.

15NB-ARC domain phylogenetic trees revealed that the NRC superclade is divided into the NRC clade (NRC-H) and a larger clade that includes all known NRC-dependent sensor NLRs (NRC-S). We noted that even though the NRC-H and NRC-S are sister clades based on NB-ARC phylogenetic analyses, they grouped into distinct N-terminal domain tribes in the Tribe-MCL analyses (Figure 6A). Whereas all NRC-H mapped to Tribe 2, NRC-S clustered into eight different tribes (Figure 6A). This pattern indicates that unlike the NRCs, the N-terminal sequences of their NRC-S mates have diversified throughout evolutionary time.

16Next, we mapped the occurrence of the MADA motif onto the NB-ARC phylogenetic tree and noted that the distribution of the MADA motif was uneven across the NRC superclade despite their phylogenetic relationship (Figure 6B). Whereas 20 out of 22 NRC-H have a predicted MADA motif at their N-termini, none of the 117 examined NRC-S were predicted as MADA-CC-NLR in the HMMER search (Figure 6B). In fact, 65 of 117 NRC-S, including the well know disease resistance proteins R1, Prf, Sw5b, Hero, Rpi-blb2 and Mi-1.2, have N-terminal extensions of ~600 amino acids, or more in the case of Prf, prior to their predicted CC domains (Figure 6B). These findings indicate the CC domains of NRCs and their NRC-S mates have experienced distinct evolutionary trajectories even though these NLR proteins share a common evolutionary origin.

17To experimentally validate our bioinformatic analyses, we performed site directed mutagenesis to determine the degree to which the MADA motif is required for the activity of NRC4. First, we followed up on the ZAR1 structure-function analyses of who showed that three amino acids (phenylalanine 9 [F9], leucine 10 [L10] and leucine 14 [L14]) within the α1 helix/MADA motif are required for ZAR1-mediated cell death and bacterial resistance. We introduced a triple alanine substitution similar to the mutant of into the autoactive NRC4DV and found that this L9A/V10A/L14A mutation significantly reduced, but did not abolish, NRC4DV cell death inducing activity (Figure 7A–C). Given that the MADA motif, particularly the mutated L9, V10 and L14 sites, is primarily composed of hydrophobic residues, we reasoned that substitutions with the negatively charged glutamic acid (E) would be more disruptive than hydrophobic alanine. Therefore, we substituted L9, V10 and L14 with glutamic acid, and observed that the L9E/V10E/L14E mutation resulted in a more severe disruption of the cell death activity of NRC4DV compared to the triple alanine mutant (Figure 7A–C). Both of the NRC4DV triple alanine and glutamic acid mutant proteins accumulated to similar levels as NRC4DV when expressed in N. benthamiana leaves indicating that the observed loss-of-function phenotypes were not due to protein destabilization (Figure 7D).

18We further introduced the triple alanine mutation to NRC41-29-YFP and ZAR11-144-YFP (Figure 7—figure supplement 1A). ZAR11-144 matches the ZAR1 CC domain and is known to trigger cell death when expressed fused to a YFP tag. The triple alanine mutation abolished the cell death triggered by both NRC41-29-YFP and ZAR11-144-YFP, supporting the view that MADA motifs are essential for the capacity of the N-termini of NRC4 and ZAR1 to cause cell death (Figure 7—figure supplement 1B–D).

19Next, we performed single alanine and glutamic acid mutant scans to reveal which other residues in the MADA motif are required for NRC4-mediated cell death. None of the tested single alanine-substituted mutants affected the cell death response of NRC4DV (Figure 8—figure supplement 1). In contrast, single glutamic acid mutations L9E, L13E and L17E essentially abolished the cell death activity of NRC4DV without affecting the stability of the mutant proteins (Figure 8). Therefore, we determined that the L9, L13, and L17 residues in the MADA motif are critical for cell death induction by NRC4.

20Finally, we mapped L9, L13 and L17 onto a homology model of the CC domain of NRC4 produced based on the ZAR1 resistosome structure of (Figure 8—figure supplement 2). All three residues mapped to the outer surface of the funnel-shaped structure formed by the α1 helices similar to the previously identified residues in positions 9, 10 and 14. These results suggest that the outer surface of the funnel-shaped structure formed by N-terminal helices is critical not only for the function of ZAR1 but also for the activity of another MADA-CC-NLR.

21The ZAR1 model postulates that the resistosome translocates into the plasma membrane through the α1 helix which matches the MADA motif. To investigate the intracellular dynamics of the MADA motif, we analysed the subcellular distribution of NRC41-29-YFP in N. benthamiana leaves (Figure 9A). Interestingly, unlike free YFP which typically shows nucleocytoplasmic distribution, NRC41-29-YFP produced fluorescence signal in punctate structures throughout the cell in addition to relatively weak nucleocytoplasmic signal (Figure 9A). Furthermore, we merged both the z-stack and single plain images of the YFP proteins with the plasma membrane marker RFP-Rem1.3. Although the NRC41-29-YFP puncta did not completely overlap with RFP-Rem1.3 signal, we noticed some of the NRC41-29-YFP puncta associated with the plasma membrane (Figure 9A–B).

22To further study the NRC41-29-YFP puncta, we examined puncta formation of the YFP A206K mutant, which shows reduced cell death by NRC41-29-YFP (Figure 2—figure supplement 2). In contrast to NRC41-29-YFP, NRC41-29-YFPA206K rarely formed puncta (Figure 9A,C), suggesting that YFP self-assembly is required for NRC41-29-YFP puncta formation. Furthermore, introducing the L9E in NRC41-29-YFP greatly reduced puncta formation (Figure 9A,C). This finding directly connects puncta formation to the activity of full length NRC4 given that L9E also affects NRC4 cell death activity (Figure 8). Taken together, these results indicate that both an intact MADA motif and YFP oligomerization are required for the capacity of NRC41-29-YFP to form puncta as well as cause cell death in N. benthamiana leaves.

23Our observation that the ZAR1 α1 helix has sequence similarity to the N-terminus of NRC4 prompted us to determine whether this sequence is functionally conserved between these two proteins. To test this hypothesis, we swapped the first 17 amino acids of NRC4DV with the equivalent region of ZAR1 (Figure 10A–B). The resulting ZAR11-17-NRC4 chimeric protein can still trigger cell death in N. benthamiana leaves indicating that the MADA/α1 helix sequence is functionally equivalent between these two NLR proteins (Figure 10C, Figure 10—figure supplement 1).

24Next, we swapped the same 17 amino acids of NRC4 with the matching sequences of the MADA-CC-NLRs NRC2 from N. benthamiana, RPP8 and RPP13 from Arabidopsis, and Pik-2 and Os03g30910.1 from rice, all of which gave HMMER scores > 10.0 and ranging from 30.8 to 10.4 (Figure 10A–B). All of the assayed chimeric NRC4DV proteins retained the capacity to trigger cell death in N. benthamiana leaves (Figure 10C, Figure 10—figure supplement 1). We determined whether the N-termini of MADAL-CC-NLRs Arabidopsis RPM1 and barley MLA10, which yielded respective HMMER scores of 9.3 and 7.8, could also replace the first 17 amino acids of NRC4DV (Figure 10A–B). Both NRC4DV chimeras retained the capacity to trigger cell death indicating that these MADAL sequences are functionally analogous to the NRC4 N-terminus (Figure 10C, Figure 10—figure supplement 1). These results indicate that the MADA motif is functionally conserved even between distantly related NLRs from dicots and monocots.

25We further swapped the 17 amino acids of NRC4DV with N-terminal sequences from Arabidopsis LOV1 (AT1G10920), pepper Bs2 and potato Rx, all of which were not predicted to have a MADA sequences by HMMER searches (Figure 10A–B). LOV1 was among the 13.7% of Tribe 2 NLRs that were not predicted to have a MADA/MADAL motif. Bs2 and Rx are NRC-S NLRs that belong to different tribes—Tribe 11 and 25, respectively (Figure 6A). The N-terminal sequences of Bs2 and Rx are somewhat similar to MADA sequences but were negative in the HMMER analyses (Figure 10A). Interestingly, whereas the N-termini of Bs2 and LOV1 did not complement the cell death activity when swapped into NRC4DV, Rx1-17 could confer cell death activity when swapped into NRC4DV (Figure 10C, Figure 10—figure supplement 1). This exception indicates that at least one of the N-terminal sequences that are not predicted as having the MADA motif may still functionally complement the N-terminus of NRC4.

26We investigated whether the MADA motif of NRC4 is required for disease resistance against the oomycete pathogen Phytophthora infestans. One of the NRC4-dependent sensor NLRs is Rpi-blb2, an NRC-S protein from Solanum bulbocastanum that confers resistance to P. infestans carrying the matching effector AVRblb2. For this purpose, we set up a genetic complementation assay in which NRC4 is co-expressed with Rpi-blb2 in leaves of the N. benthamiana nrc4a/b_9.1.3 mutant prior to inoculation with the P. infestans strain 88069, that carries AVRblb2 (Figure 11A). Unlike wild-type NRC4, the NRC4 L9A/V10A/L14A and L9E mutants failed to rescue the resistance to P. infestans in the N. benthamiana nrc4a/b_9.1.3 mutant, indicating that MADA motif mutations not only impair HR cell death as shown above but also affect disease resistance against an oomycete pathogen (Figure 11B). We conducted similar complementation assays with the ZAR11-17-NRC4 chimera in which the first 17 amino acids of NRC4 were swapped with the equivalent region of ZAR1, and found that ZAR11-17-NRC4 complemented the nrc4a/b_9.1.3 N. benthamiana mutant to a similar degree as wild-type NRC4 (Figure 11B). These experiments further confirm that the α1 helix/MADA motif of Arabidopsis ZAR1 is functionally equivalent to the N-terminus of NRC4, and that the chimeric ZAR11-17-NRC4 is not only able to trigger HR cell death but also retains its capacity to function with its NRC-S mate Rpi-blb2 and confer resistance to P. infestans.

27This study stems from a random truncation screen of the CC-NLR NRC4, which revealed that the very N-terminus of this protein is sufficient to carry out the HR cell death activity of the full-length protein. It turned out that this region is defined by a consensus sequence—the MADA motif—that occurs in about one fifth of plant CC-NLRs including Arabidopsis ZAR1. The MADA motif covers most of the functionally essential α1 helix of ZAR1 that undergoes a conformational switch during activation of the ZAR1 resistosome. Our finding that the ZAR1 α1 helix/MADA motif can functionally replace its matching region in NRC4 indicates that the ZAR1 ‘death switch’ mechanism may apply to NRCs and other MADA-CC-NLRs from dicot and monocot plant species.

28We recently proposed that NLRs may have evolved from multifunctional singleton receptors to functionally specialized and diversified receptor pairs and networks. In this study, a striking finding from the computational analyses is that all NRC-S lack the MADA motif even though they are more closely related to NRC-H than to ZAR1 and other MADA-CC-NLRs in the NB-ARC phylogenetic tree (Figure 6). These observations led us to draw the evolutionary model of Figure 12. In this model, we propose that MADA-type sequences have emerged early in the evolution of CC-NLRs and have remained conserved from singletons to helpers in NLR pair and network throughout evolution. In sharp contrast, MADA sequences appear to have degenerated over time in sensor CC-NLRs as these proteins specialized in pathogen detection and lost the capacity to execute the immune response without their helper mates. Consistent with this view, NRC-H are known to be more highly conserved than their NRC-S partners within the Solanaceae. Future analyses will determine whether MADA-CC-NLRs are generally more evolutionarily constrained than non-MADA containing NLRs.

29In addition, about half of the NRC-S proteins have acquired N-terminal extensions (N-terminal domains) before their CC domain, which would preclude a free N-terminal α1 helix essential for a ZAR1 type ‘death switch’ mechanism (Figure 6). In fact, the N-terminal domains of Prf and Sw5b function as baits that sense pathogen effectors, suggesting functional analogy to integrated effector detection motifs found in some NLRs, and are not known to be involved in executing the immune response. Here, we hypothesize that the CC domains of these and other sensor NLRs have extensively diversified over evolutionary time and are losing the capacity to function as HR cell death executors. This could be a consequence of relaxed selection given that these proteins rely on their MADA-CC-NLR partners to execute the immune response as discussed above. Additional structure-function experiments will be needed to determine the extent to which this ‘use-it-or-lose-it’ evolutionary model applies to the sensor sub-class of NLR immune receptors.

30Understanding the precise nature of the N-terminal sequences that can functionally replace the α1 helix requires further investigation. In the MADA motif swap experiments, we found one exception to the correlation between MADA predictions and functional complementation of NRC4. The N-terminal sequence of the NRC-S NLR Rx, which was negative in the MADA HMMER searches, complemented the cell death activity of NRC4 MADA motif (Figure 10, Figure 10—figure supplement 1). Nonetheless, previously the NB domain of Rx was reported to be capable of triggering cell death, suggesting that the CC domain of Rx is dispensable for activation of HR. Therefore, in our ‘use-it-or-lose-it’ model, the N-termini of some NRC-S may not have fully degenerated into non-functional sequences and may have residual ability to functionally complement MADA. In the future, it would be fascinating to determine resistosome configurations of NLR sensor and helper hetero-complexes. As discussed elsewhere, one hypothesis is that sensor NLRs associate with the resistosome as functional equivalents of RLCKs in the ZAR1 resistosome. Another is that sensor NLRs form one of the wheel spokes in a hetero-oligomeric resistosome as in the mammalian NAIP/NLRC4 inflammasome. It is possible that in this configuration, the N-terminus of a sensor NLR such as Rx remains evolutionarily constrained in terms of length and sequence composition. Future structural analyses of NLR sensor/helper heterocomplexes are needed to address these questions.

31Already, our evolutionary model appears to be consistent with some paired NLR configurations in addition to the NRC-H/NRC-S network. One example is rice Pik-1 and Pik-2, which are a well-established NLR pair that detects the AVRPik effector of the rice blast fungus M. oryzae. AVRPik binding to the integrated heavy metal associated (HMA) domain of Pik-1 results in HR cell death and blast fungus resistance only in the presence of its helper Pik-2 protein. In our computational analyses only Pik-2 was detected to carry an N-terminal MADA motif (Figure 5, HMM score = 10.4) even though the CC domains of both proteins grouped into Tribe 1 (Figure 3). The Pik-2 MADA motif could substitute for the N-terminus of NRC4 in our cell death assays despite having six additional amino-acids at its N-terminus (Figure 10). These results are consistent with our Figure 11 model and imply that the helper NLR Pik-2 may execute HR cell death via its N-terminal MADA motif whereas its paired sensor NLR Pik-1 does not have the capacity to carry this activity on its own.

32In addition to ZAR1, RPP8 is another Arabidopsis MADA-CC-NLR with high similarity to the N-terminus of NRC4 with nine invariant amino acids out of 17 (53%; HMMER score = 30.8). This RPP8 MADA motif could substitute for the N-terminus of NRC4 indicating that it is functional (Figure 10). In Arabidopsis, RPP8 (AT5G43470) and its paralogs occur at dynamic genetic loci that exhibit frequent sequence exchanges as deduced from comparative genomic analyses. Four of the five RPP8 paralogs in the Arabidopsis ecotype Col-0 were deemed to have a MADA motif based on our HMMER searches, whereas a fifth paralog LOV1 (AT1G10920) was negative and did not complement NRC4 autoactivity in the MADA motif swap experiments (Figure 10, Figure 10—figure supplement 1). LOV1 confers sensitivity to the victorin effector produced by the necrotrophic fungus Cochliobolus victoriae by binding the defense-associated thioredoxin TRX-h5 when it is complexed with victorin. Interestingly, LOV1 binds TRX-h5 via its CC domain indicating that this region has evolved a pathogen sensor activity in this NLR protein. How the sensor activity of the CC domain of LOV1 relates to the absence of a detectable MADA motif and whether this protein relies on other MADA-CC-NLRs to execute the cell death response are unanswered questions that are raised by these observations.

33In activated ZAR1 resistosome, a funnel-shaped structure formed by five α1 helices is thought to directly execute hypersensitive cell death by forming a toxin-like pore in the plasma membrane. To what extent do activated MADA-CC-NLRs function according to this ZAR1 model? Structure informed mutagenesis of ZAR1 revealed that F9, L10 and L14 on the outer surface of the funnel-shaped structure are required for immunity. Here, our Ala and Glu scans of the MADA motif revealed that the NRC4 L9, L13 and L17 residues are essential for HR cell death activity. All three residues mapped to the outer surface of NRC4 α1 helices as predicted from a homology model based on the ZAR1 resistosome (Figure 8—figure supplement 2). We also found that mutations that perturb the MADA motif and prevent YFP self-association impair the capacity of NRC41-29-YFP to cause cell death and form puncta in N. benthamiana leaf cells (Figure 2—figure supplement 2, Figure 7—figure supplement 1, Figure 9). Our current interpretation of these results is that NRC41-29-YFP forms high-order complexes to cause cell death. However, direct support for this hypothesis is still missing. In addition, we lack detailed analyses of the cellular dynamics of the NRC41-29-YFP puncta and the degree to which they associate with membrane compartments in living plant cells. In the future, further biochemical, structural and cellular analyses are needed to determine the precise nature of the broadly conserved MADA motif and address the extent to which the ZAR1 ‘death switch’ model occurs in CC-NLRs.

34As discussed by, the interior space of the funnel structure is also important because the ZAR1 double mutant E11A/E18A is impaired in cell death and disease resistance activities. However, in our Glu mutant scan, we failed to observe a reduction in HR cell death activities with single site mutants in these residues or other amino acids that are predicted to line up the interior space of the funnel-shaped structure. Whether or not this reflects genuine biological differences between ZAR1 and NRC4 remains to be studied.

35A subset of CC-NLRs of the RPW8/HR family of atypical resistance proteins have a distinct type of coiled-coil domain known as CCR. We failed to detect any MADA type sequences in these CCR-NLR proteins. Indeed, the CCR domain has similarity to mixed lineage kinase domain-like (MLKL) proteins and fungal HeLo/HELL domains, which form multi-helix bundles and act as membrane pore forming toxins. Whether the CCR domains function as a distinct cell death inducing system in plants compared to MADA-CC-NLRs remains to be determined. Interestingly, Arabidopsis HR4, a CCR containing protein, interacts in an allele-specific manner with the genetically unlinked CC-NLR RPP7b to trigger autoimmunity in the absence of pathogens. Recently, showed that RPP7b forms higher-order complexes of six to seven subunits only when activated by the matching autoimmune HR4Fei-0 protein in a biochemical process reminiscent of activated ZAR1 resistosome. In our HMMER searches, RPP7b and its four Arabidopsis paralogs were all classed as carrying the MADA motif. Thus, findings by directly link a MADA-CC-NLR to the formation of resistosome type structures consistent with our view that the ZAR1 model widely applies to other NLRs with the MADA α1 helix. It will be fascinating to determine whether or not RPP7b and HR4 are both capable of executing cell death, especially as two-component systems of NLR and HeLo/HELL proteins are common in fungi and mammals.

36Plant NLRs can be functionally categorized into singleton, sensor or helper NLRs based on their biological activities. However, it remains challenging to predict NLR functions from the wealth of unclassified NLRomes that are emerging from plant genome sequences. It has not escaped our attention that the discovery of the MADA motif as a signature of NLR singletons and helpers—but missing in sensor NLRs—enables the development of computational pipelines for predicting NLR networks from naïve plant genomes. Such in silico predictions can be tested by co-expression of paired NLRs in N. benthamiana. In addition, MADA motif predictions can be validated using our straightforward functional assay of swapping the NRC4 N-terminus, with the readouts consisting of both HR cell death (Figure 10) and resistance to P. infestans (Figure 11). Dissecting the NLR network architecture of plant species is not only useful for basic mechanistic studies but has also direct implications for breeding disease resistance into crop plants and reducing the autoimmune load of NLRs.

37Wild type and mutant N. benthamiana were propagated in a glasshouse and, for most experiments, were grown in a controlled growth chamber with temperature 22–25°C, humidity 45–65% and 16/8 hr light/dark cycle.

38Constructs for generating NRC4 knockout N. benthamiana were assembled using the Golden Gate cloning method. sgRNA4.1 and sgRNA4.2 were cloned under the control of the Arabidopsis (Arabidopsis thaliana) U6 promoter (AtU6pro) [pICSL90002, The Sainsbury Laboratory (TSL) SynBio] and assembled in pICH47751 (Addgene no. 48002) and pICH47761 (Addgene no. 48003), respectively as previously described. Primers sgNbNRC4.1_F (tgtggtctcaATTGAAAAACGGTACATACCGCAGgttttagagctagaaatagcaag), sgNbNRC4.2_F (tgtggtctcaATTGAGTCAGGAATCTTGCAGCTGgttttagagctagaaatagcaag) and sgRNA_R (tgtggtctcaAGCGTAATGCCAACTTTGTAC) were used to clone sgRNA4.1 and sgRNA4.2. pICSL11017::NOSpro::BAR (TSL SynBio), pICSL11021::35Spro::Cas9 (Addgene no. 49771), pICH47751::AtU6p::sgRNA4.1, pICH47761::AtU6pro::sgRNA4.2, and the linker pICH41780 (Addgene no. 48019) were assembled into the vector pICSL4723 (Addgene no. 48015) as described resulting in construct pICSL4723::BAR::Cas9::sgRNA4.1::sgRNA4.2 that was used for plant transformation. Transgenic N. benthamiana were generated by TSL Plant Transformation team as described before.

39Genomic DNA of selected T2 N. benthamiana transgenic plants nrc4a/b_9.1.3 and nrc4a/b_1.2.1 was extracted using DNeasy Plant DNA Extraction Kit (Qiagen). Primers NRC4_1_F (GGAAGTGCAAAGGGAGAGTT), NRC4_1_R (TCGCCTGAACCACAAACTTA), NRC4_2_F (GGCAAGAATTTTGGATGTGG) and NRC4_2_R (CGAGGAACCCTTTTTAGGCAG) were used in multiplex polymerase chain reaction (PCR) assays to amplify the region targeted by the two sgRNAs. Multiplex amplicon sequencing was performed by the Hi-Plex technique. Sequence reads were aligned to the reference N. benthamiana draft genome Niben.genome.v0.4.4 [Sol Genomics Network (SGN), https://solgenomics.net/], and NRC4a (on scaffold Niben044Scf00002971) and NRC4b (on scaffold Niben044Scf00016103) were further analysed. T3 lines from the selected T2 plants were used for the experiments.

40To generate NRC41-29-YFP expression construct, NRC41-29 coding sequence was amplified by Phusion High-Fidelity DNA Polymerase (Thermo Fisher), and the purified amplicon was directly used in Golden Gate assembly with pICH85281 [mannopine synthase promoter+Ω (MasΩpro), Addgene no. 50272], pICSL50005 (YFP, TSL SynBio), pICSL60008 [Arabidopsis heat shock protein terminator (HSPter), TSL SynBio] into binary vector pICH47742 (Addgene no. 48001). Primers used for NRC41-29 coding sequences are listed in Supplementary file 1.

41To generate an autoactive mutant of N. benthamiana NRC4, the aspartic acid (D) in the MHD motif was substituted to valine (V) by site-directed mutagenesis using Phusion High-Fidelity DNA Polymerase (Thermo Fisher). pCR8::NRC4WT was used as a template. Primers NRC4_D478V_F (5’-Phos/ATGTTGCATCAGTTCTGCAAAAAGGAGGCT) and NRC4_D478V_R (5’-Phos/GACGTGAAGACGACATGTTTTTATTTGACC) were used for introducing the mutation in the PCR. The mutated NRC4 was verified by DNA sequencing of the obtained plasmid.

42pCR8::NRC4WT or pCR8::NRC4DV without its stop codon were used as a level 0 modules for the following Golden Gate cloning. NRC4DV-3xFLAG was generated by Golden Gate assembly with pICH51266 [35S promoter+Ω promoter, Addgene no. 50267], pICSL50007 (3xFLAG, Addgene no. 50308) and pICH41432 (octopine synthase terminator, Addgene no. 50343) into binary vector pICH47732 (Addgene no. 48000). NRC4WT-6xHA and NRC4DV-6xHA were generated by Golden Gate assembly with pICH85281 (MasΩpro), pICSL50009 (6xHA, Addgene no. 50309), pICSL60008 (HSPter) into the binary vector pICH47742. NRC4WT-YFP and NRC4DV-YFP were generated by Golden Gate assembly with pICH85281 (MasΩpro), pICSL50005 (YFP), pICSL60008 (HSPter) into binary vector pICH47742. For free YFP expression construct, pAGM3212 (YFP, TSL SynBio) was assembled with pICH85281 (MasΩpro) and pICSL60008 (HSPter) into the binary vector pICH47742 by Golden Gate reaction.

43To reduce homo-affinity of YFP, YFP alanine (A) 206 was substituted to lysine (K), by site-directed mutagenesis using Phusion High-Fidelity DNA Polymerase (Thermo Fisher). pAGM3212 (YFP, TSL SynBio) was used as a template. Primers used for mutagenesis are listed in Supplementary file 1. The amplicons were directly used in Golden Gate assembly with pICH41308 (Addgene no. 47998) or pAGM1301 (Addgene no. 47989). pICH41308::YFPA206K was assembled with pICH85281 (MasΩpro) and pICSL60008 (HSPter) into the binary vector pICH47742 by Golden Gate reaction. pAGM1301::YFPA206K was assembled with pCR8::NRC4DV or NRC41-29 amplicon, pICH85281 (MasΩpro) and pICSL60008 (HSPter) into the binary vector pICH47742 by Golden Gate reaction.

44To generate MADA motif mutants and chimeras of NRC4, the full-length sequence of NRC4WT or NRC4DV was amplified by Phusion High-Fidelity DNA Polymerase (Thermo Fisher) with the forward primers listed in Supplementary file 1. Purified amplicons were cloned into pCR8/GW/D-TOPO (Invitrogen) as a level 0 module. The level 0 plasmids were then used for Golden Gate assembly with pICH85281 (MasΩpro), pICSL50009 (6xHA) and pICSL60008 (HSPter) into the binary vector pICH47742.

45To generate pTRBO::YFP, pTRBO::ZAR11-144-YFP, pTRBO::ZAR11-144F9A/L10A/L14A-YFP, pTRBO::NRC41-29-YFP and pTRBO::NRC41-29L9A/V10A/L14A-YFP plasmids, we used GENEWIZ Standard Gene Synthesis with custom vector cloning service into the pTRBO vector.

46To generate the Mu-STOP transposon, entranceposon M1-KanR (Mutation Generation System Kit, Thermo Fisher) was used as a PCR template, and three translational stop signals were added to each transposon end by Phusion High-Fidelity DNA Polymerase and Mu-STOP primer (GGAAGATCTGATTGATTGAACGAAAAACGCGAAAGCGTTTC). The 3’ A overhang was then introduced to the Mu-STOP amplicon by DreamTaq DNA polymerase (Thermo Fisher), and the resulting Mu-STOP amplicon was cloned into pGEM-T Easy (Promega). Mu-STOP transposon was then released from pGEM::Mu-STOP by BglII digestion and purified by GeneJET Gel Extraction Kit (Thermo Fisher). 100 ng of the purified Mu-STOP transposon was mixed with 500 ng of the target plasmid, pICH47732::35SΩpro::NRC4DV-3xFLAG, and MuA transposase from the Mutation Generation System Kit (Thermo Fisher). The in vitro transposition reaction was performed according to the manufacturer’s procedure and carried out at 30°C for 6 hr.

47The NRC4DV::Mu-STOP library was transformed into Agrobacterium tumefaciens Gv3101 by electroporation. Mu-STOP insertion sites were determined by colony PCR using DreamTaq DNA polymerase (Thermo Fisher) and PCR amplicon sequencing. For the PCR, we used a forward primer (GAACCCTGTGGTTGGCATGCACATAC) matching pICH47732 and a reverse primer (CAACGTGGCTTACTAGGATC) matching Mu-STOP transposon.

48Transient expression of NRC wild-type and mutants, as well as other genes, in N. benthamiana were performed by agroinfiltration according to methods described by. Briefly, four-weeks old N. benthamiana plants were infiltrated with A. tumefaciens strains carrying the binary expression plasmids. A. tumefaciens suspensions were prepared in infiltration buffer (10 mM MES, 10 mM MgCl2, and 150 μM acetosyringone, pH5.6) and were adjusted to OD600 = 0.5. For transient expression of NRC4WT-YFP, NRC4DV-YFP, NRC41-29-YFP, free YFP and the YFPA206K variants, the A. tumefaciens suspensions (OD600 = 0.25) were mixed in a 1:1 ratio with an A. tumefaciens expressing p19, the suppressor of posttranscriptional gene silencing of Tomato bushy stunt virus that is known to enhance in planta protein expression. HR cell death phenotypes were scored according to the scale of modified to range from 0 (no visible necrosis) to 7 (fully confluent necrosis). In Figure 2—figure supplement 2 and Figure 7—figure supplement 1, cell death was visualized with Odyssey Infrared Imager (800 nm channel, LI-COR).

49Protein samples were prepared from six discs (8 mm diameter) cut out of N. benthamiana leaves at 1 day after agroinfiltration and were homogenised in extraction buffer [10% glycerol, 25 mM Tris-HCl, pH 7.5, 1 mM EDTA, 150 mM NaCl, 2% (w/v) PVPP, 10 mM DTT, 1x protease inhibitor cocktail (SIGMA), 0.2% IGEPAL (SIGMA)]. The supernatant obtained after centrifugation at 12,000 xg for 10 min was used for SDS-PAGE. Immunoblotting was performed with HA-probe (F-7) HRP (Santa Cruz Biotech) or anti-GFP antibody (ab290, abcam) in a 1:5000 dilution. Equal loading was checked by taking images of the stained PVDF membranes with Pierce Reversible Protein Stain Kit (#24585, Thermo Fisher).

50We used NLR-parser to identify NLR sequences from the protein databases of tomato (SGN, Tomato ITAG release 2.40), N. benthamiana (SGN, N. benthamiana Genome v0.4.4), Arabidopsis (https://www.araport.org/, Araport11), sugar beet (http://bvseq.molgen.mpg.de/index.shtml, RefBeet-1.2), rice (http://rice.plantbiology.msu.edu/, Rice Gene Models in Release 7) and barley (https://www.barleygenome.org.uk/, IBSC_v2). The obtained NLR sequences, from NLR-parser, were aligned using MAFFT v. 7, and the protein sequences that lacked the p-loop motif were discarded from the NLR dataset. The gaps in the alignments were deleted manually in MEGA7 and the NB-ARC domains were used for generating phylogenetic trees (Figure 3—figure supplement 1—source data 1). The neighbour-joining tree was made using MEGA7 with JTT model and bootstrap values based on 100 iterations (Figure 3—figure supplement 1). We removed TIR-NLR clade members from the final database, and retained all CC-NLR sequences, including the CCR-NLR (RPW8-NLR), that possess N-terminal domains longer than 30 amino acids (988 protein sequences, Figure 3—source data 1).

51The NB-ARC domain sequences from 988 proteins (Figure 3—figure supplement 2—source data 2) were used to construct the CC-NLR phylogenetic tree in Figure 3—figure supplement 2. The neighbour-joining tree was constructed as described above.

52For the tribe analyses, we extracted the N-terminal domain sequences, prior to NB-ARC domain, from the CC-NLR database (Figure 3—source data 2), and used the Tribe-MCL feature from Markov Cluster Algorithm to cluster the sequences into tribes with BLASTP E-value cutoff <10−8. NLRs in each tribe were subjected to motif searches using the MEME (Multiple EM for Motif Elicitation) v. 5.0.5 with parameters ‘zero or one occurrence per sequence, top five motifs’, to detect consensus motifs conserved in ≥ 70% of input sequences.

53We used the most N-terminal motif detected in Tribe 2 from the MEME analysis to construct a hidden Markov model (HMM) for the MADA motif. Sequences aligned to the MADA motif were extracted in Stockholm format and used in hmmbuild program implemented in HMMER v2.3.2. The HMM was then calibrated with hmmcalibrate. This MADA-HMM (Supplementary file 2) was used to search the CC-NLR database (Figure 3—source data 1) with the hmmsearch program (hmmsearch --max -o < outputfile > <hmmfile > <seqdb > ). To estimate the false positive rate, hmmsearch program was applied to full Arabidopsis and tomato proteomes (Araport11 and ITAG3.2) with the MADA-HMM and the output is displayed in Figure 4—source data 1 and discussed in the results section.

54P. infestans infection assays were performed by applying droplets of zoospore suspension on detached leaves as described previously. Briefly, leaves of five-weeks old wild-type and nrc4a/b N. benthamiana plants were infiltrated with A. tumefaciens solutions, in which each Agrobacterium containing a plasmid expressing RFP::Rpi-blb2 was mixed in a 1:1 ratio (OD600 = 0.5 for each strain) with Agrobacterium containing either the empty vector, wild type NRC4, or NRC4 variant. At 24 hr after agroinfiltration, the abaxial side of the leaves were inoculated with 10 µL zoospore suspension (100 zoospores/μL) of P. infestans strain 88069 prepared according to the methods reported by. The inoculated leaves were kept in a moist chamber at room temperature (21–24°C) for 7 days, and imaged under UV light (UVP Blak-Ray B-100AP lights – 365 nm) with Wratten No.8 Yellow Filter for visualization of the lesions. The camera setting was ISO 1600, White Balance 6250K, F11 and 10 s exposure.

55We used the cryo-EM structure of activated ZAR1 as template to generate a homology model of NRC4. The amino acid sequence of NRC4 was submitted to Protein Homology Recognition Engine V2.0 (Phyre2) for modelling (Kelley et a., 2015). The coordinates of ZAR1 structure (6J5T) were retrieved from the Protein Data Bank and assigned as modelling template by using Phyre2 Expert Mode. The resulting model of NRC4 comprised amino acids Val-5 to Glu-843 and was illustrated in CCP4MG software.

56For localization analyses, leaf discs (6 mm in diameter) of N. benthamiana leaves were made 2 days after agroinfiltration and were used for imaging. Images were captured with Leica SP8 resonant inverted confocal microscope (Leica Microsystems). For excitation, Argon laser and Helium-Neon laser wer set to 514 nm and 633 nm, respectively. Hybrid detectors were used with 517–575 and 584–638 nm bandpass filters to capture YFP and RFP signals, respectively. Gain, laser intensities and zoom were kept the same for all images. Images were processed in FIJI (Fiji Is Just ImageJ).

57The NRC4 sequences used in this study can be found in the Solanaceae Genomics Network (SGN) or GenBank/EMBL databases with the following accession numbers: NbNRC4 (NbNRC4, MK692737; NbNRC4a, Niben044Scf00002971; NbNRC4b, Niben044Scf00016103).