The ion channel ppk301 controls freshwater egg-laying in the mosquito Aedes aegypti

1A female Ae. aegypti mosquito must take a blood-meal to develop a batch of eggs. Many strains of Ae. aegypti are anthropophilic, meaning that they target humans as their preferred blood source. Once proteins and other nutrients in the blood have been converted into eggs, a female mosquito must find a suitable body of freshwater to lay these eggs. Larval and pupal stages of Ae. aegypti are aquatic and thus the choice of egg-laying site is a primary determinant of offspring survival. In the field, Ae. aegypti often lay eggs in small containers of freshwater, such as drinking water storage containers, discarded tires, clogged gutters, and other by-products of human settlement, likely contributing to their pernicious ability to adapt and colonize human settlements across the globe.

2The act of choosing an egg-laying site in many insects, including Ae. aegypti, is a deliberate and evaluative behavior. A female Ae. aegypti mosquito with a fully developed batch of eggs will use elevated humidity and bacterial volatiles to locate water at a distance. Once in close-range, a mosquito contacts water to evaluate its suitability for egg-laying by sensing a wide variety of cues that include salinity, food, bitter toxins, and animal-derived chemical signals indicating the density of conspecific larvae and pupae or the presence of predators. The physiological mechanisms by which a mosquito senses the presence of water and evaluates its composition to safely nurture her offspring remain unknown.

3Here, we show that the DEG/ENaC channel ppk301 is required for mosquitoes to exploit freshwater egg-laying substrates. When ppk301 mutant females contact water, they do not lay eggs as readily as wild-type animals and are more likely to make aberrant decisions between freshwater and saltwater at concentrations that impair offspring survival. We developed a CRISPR-Cas9-based genetic knock-in strategy to build genetic tools for labeling and imaging molecularly defined populations of neurons and generated a reporter line expressing the QF2 transcriptional activator from the endogenous ppk301 locus. We found that ppk301 is expressed in sensory neurons in legs and proboscis, appendages that directly contact water, and that sensory afferents from these ppk301-expressing neurons project to central taste centers. Using in vivo calcium imaging with the genetically encoded calcium sensor GCaMP6s at the axonal terminals of ppk301-expressing neurons in the ventral nerve cord, we found that ppk301 neurons respond to freshwater and that this response was almost entirely abolished in ppk301 mutant animals. Surprisingly, these projections were also activated by salt in both wild-type and ppk301 animals. We propose that ppk301 drives egg-laying at low-salt concentrations and that egg-laying is inhibited by a ppk301-independent pathway at high-salt concentrations.

4We observed Ae. aegypti egg-laying behavior in the laboratory to understand the range of sensory information that is integrated to guide the final decision to lay an egg. A female Ae. aegypti mosquito with a fully developed batch of eggs will first evaluate a potential egg-laying site by physical contact with some combination of sensory tissues that include all three pairs of legs and her proboscis. If a site is deemed suitable, she will lay eggs singly on the moist substrate above the waterline (Figure 1A, Video 1). When we used a mesh barrier to block access to liquid water, females did not lay eggs, even though they had free access to the moist filter paper substrate (Figure 1B,C). Together, this suggests that direct contact with liquid water is necessary to stimulate egg-laying in Ae. aegypti and we set out to probe the molecular and cellular basis of this water-sensation to better understand this critical mosquito behavior.

5As a consequence of their global spread, Ae. aegypti are faced with diverse habitats with a wide variety of potential egg-laying sites. For example, they can be found in abundance in a number of coastal regions rich with standing saltwater. To mimic the choice between freshwater and seawater in the lab, we developed a two-choice assay in which individual blood-fed females were placed in a container with a divided Petri dish filled with deionized water on one side and varying concentrations of a chemically defined artificial seawater solution on the other (Figure 1D, Supplementary file 1). Mosquitoes showed no significant preference between deionized water and dilute seawater up to 10%, with individual mosquitoes either picking a solution at random or distributing their eggs between both solutions (Figure 1D). However, they showed a strong dose-dependent aversion to higher concentrations of seawater, with an IC50 of 12.25% seawater (Figure 1D,E). Females showed near-complete aversion to 25–100% seawater (Figure 1D,E). These choices have consequences for the offspring. When we measured survival of offspring reared in varying concentrations of seawater, we found dose-dependent lethality (LD50 = 25.23%) (Figure 1E). To simplify the stimulus, we used sodium chloride (NaCl), the predominant salt in artificial seawater, in all subsequent experiments. Females showed dose-dependent inhibition of egg-laying with increasing concentrations of NaCl (Figure 1F) when they were only given access to a single concentration, suggesting that the preference for freshwater may be driven in part by an aversion to laying eggs in saltwater. Similar to artificial seawater, NaCl produced a dose-dependent decrease in offspring survival (Figure 1G). This demonstrates that the female mosquito’s choice of freshwater or saltwater correlates with the survival of her offspring, making this an essential decision for the propagation and fitness of the species.

6In a search for genes that control Ae. aegypti freshwater egg-laying, we reasoned that animals carrying a mutation in an egg-laying preference gene would fail to lay eggs in freshwater, inappropriately lay in saltwater, or both. pickpocket (ppk) genes are members of the Degenerin/ENaC channel superfamily and encode cation channel subunits that function as putative mechanoreceptors and chemoreceptors for a wide array of stimuli including pheromones, liquid osmolality, and salt. Through manual curation of geneset annotations, we predict that the Ae. aegypti genome contains 31 ppk genes. These are unevenly distributed across its three chromosomes. Whereas chromosome 1 has only three ppk genes, chromosome 3 has 22, including three clusters of 3–7 ppk genes (Figure 2A). The predicted protein products of many ppk genes have clear 1-to-1 orthologues in Drosophila melanogaster and the malaria mosquito Anopheles gambiae, while others are in species-specific expansions (Figure 2B). Examination of tissue-specific transcript abundance using previously published RNA-seq data reveals a broad range of expression patterns in adult tissues, including in legs, proboscis, and other sensory tissues (Figure 2C). In a previous study, we generated CRISPR-Cas9 mutations in four ppk genes (marked with arrowheads in Figure 2A,B) that we considered as candidates for controlling egg-laying.

7We first measured the ability of these mutant strains to blood-feed and found that all four were attracted to and engorged fully on the blood of a live human host (Figure 3A). To test egg-laying behavior, we introduced single blood-fed females of each strain into egg-laying vials containing a small amount of water and a filter paper as an egg-laying substrate. One mutant, ppk301, an orthologue of the Drosophila melanogaster ppk28 low-osmolality sensor, showed a defect in egg-laying. Fewer than 40% of ppk301 mutants laid more than 10 eggs (Figure 3B). To exclude the possibility that this defect was due to an inability to convert blood into developed embryos, we counted the number of mature eggs in ovaries and confirmed that there was no difference between wild-type and ppk301 mutants (Figure 3C).

8To investigate freshwater egg-laying preference in the ppk mutants, we introduced single blood-fed female mosquitoes into individual chambers containing two Petri dishes, one filled with freshwater (0 mOsm/kg NaCl) and the other with 200 mOsm/kg NaCl. Even when ppk301 mutant animals laid eggs, they laid fewer eggs than wild-type on water and more eggs than wild-type on 200 mOsm/kg NaCl (Figure 3D). We assayed these four ppk mutant strains across a range of NaCl concentrations and found a significant reduction in aversion to salt solution only in the ppk301 mutant, as measured by the proportion of animals laying eggs primarily on salt solution (Figure 3D–F). Together, these data support the conclusion that mutations in ppk301 disrupt freshwater egg-laying in two distinct ways: by dramatically reducing the drive to lay eggs in suitable, low-salt, substrates and reducing the aversion to concentrations of NaCl that are lethal to their offspring.

9If ppk301 mutant animals fail to sense water, which normally triggers mosquitoes to lay an entire clutch of eggs in a short timespan, we hypothesized that these mutants would show a delay in onset and a reduced egg-laying rate when housed in close proximity to water for many days. To ask if ppk301 mutant animals will lay eggs on water given sufficient time, we introduced individual blood-fed females into egg-laying vials containing water and monitored the number of eggs laid per female per day over 7 days. While the vast majority of wild-type and ppk301 heterozygous animals laid all their eggs within the first 2 days of being introduced into egg-laying vials, ppk301 mutant animals did not. Instead, the mutants showed increased variability in the time of egg-laying initiation and a tendency to spread egg-laying out over many days (Figure 3G–J). This slow, sustained, and variable egg-laying behavior on freshwater is consistent with a defect in sensing the water that triggers egg-laying.

10If ppk301 directly senses the osmolality or salinity of liquid, we would expect it to be expressed in the sensory appendages that contact water. At the inception of this project, genetic tools for labeling, monitoring, and manipulating neurons in Ae. aegypti did not exist. To address this gap, we developed new genetic tools in the mosquito to label all ppk301-expressing neurons and to image neuronal activity at sensory neuron terminals using the genetically encoded calcium sensor GCaMP6s. We adapted an approach in which a T2A ‘ribosomal skipping’ peptide is used to express multiple independent protein products from a single RNA transcript. We first tested the efficiency of T2A in Ae. aegypti by generating a transgene containing a membrane-targeted mCD8:GFP fusion protein and a nuclear-targeted dsRed:NLS fusion protein separated by T2A and driven from the Ae. aegypti polyubiquitin promoter (Figure 4A). Confocal microscopy revealed complete subcellular separation of the two fluorophores in individual larval body-wall cells (Figure 4A). This demonstrates that T2A functions efficiently to prevent peptide bond formation in Ae. aegypti and can be used as a tool to independently express multiple gene products from a single locus.

11To build a flexible system for expressing a diverse array of effector transgenes, we employed the Q-binary expression system for transgene amplification, which has been successfully implemented in An. gambiae malaria mosquitoes. We used CRISPR-Cas9 with the same guide RNA used to generate the ppk301 mutant to introduce an in-frame T2A sequence into the ppk301 locus followed by the QF2 transcriptional activator (Figure 4B). This is predicted to cause a loss-of-function mutation in ppk301 and also express QF2 in all ppk301-expressing cells.

12We also generated two transgenic QUAS effector strains. The first is a QUAS response element driving the expression of both cytosolic dTomato and GCaMP6s (15x-QUAS-dTomato-T2A-GCaMP6s), which allows us to simultaneously label neurons and image their activity with the genetically encoded calcium sensor GCaMP6s (Figure 4C). The second drives expression of membrane-bound GFP (15x-QUAS-mCD8:GFP), allowing us to reveal the complete morphology of the neurons in which it is expressed (Figure 4I). We looked for expression of the ppk301>dTomato-T2A-GCaMP6s reporter in the appendages that contact water during egg-laying (Figure 4D) and found that sensory neurons innervating trichoid sensilla in the labellar lobes of the proboscis (Figure 4E) were labeled. We also found labeling in the legs, primarily in the distal tarsal segments (Figure 4F).

13The mosquito central nervous system consists of a brain and a ventral nerve cord (Figure 4G). To facilitate our understanding of the neuroanatomy of Ae. aegypti in general, and the projection pattern of the ppk301 driver line in particular, we built a three-dimensional female mosquito brain atlas, in which we identified and named the major neuropils in accordance with nomenclature established by the Insect Brain Name Working Group (Figure 4H and http://mosquitobrains.org). Projections of ppk301-expressing sensory neurons in the head extend processes specifically to the subesophageal zone (Figure 4H,J). Two nerves enter each hemisphere of the subesophageal zone, arising from the proboscis and the pharynx (Figure 4J). Additionally, each leg sends projections into the ventral nerve cord, with nerves running into each neuromere (Figure 4K). Both brain and ventral nerve cord innervation patterns are consistent with these neurons mediating taste sensation. We noted that projections of ppk301-expressing neurons are also present in the male brain and ventral nerve cord (Figure 4—figure supplement 1A–C), consistent with a role for ppk301 in behaviors other than egg-laying. Labeling in both males and females was absent in genetic controls expressing either QF2 driver or QUAS effector alone (Figure 4—figure supplement 1D–K).

14We hypothesized that if ppk301-expressing neurons were promoting egg-laying, they should be maximally activated by water, and we set out to test this by functional calcium imaging in response to freshwater and behaviorally relevant concentrations of NaCl. We developed an in vivo calcium imaging preparation with GCaMP6s in ventral nerve cord sensory afferents of a mosquito presented with water or NaCl solutions on a single foreleg (Figure 5A,B). This appendage was chosen because it most frequently contacts water during egg-laying (Figure 1A, Video 1). We imaged the prothoracic segment of the ventral nerve cord with two-photon microscopy, using a custom fluidics device to deliver and retract liquids to the foreleg and compared responses to different stimuli within individual animals. ppk301-expressing neuronal projections in the ventral nerve cord were identified by dTomato expression (Figure 5C), which was also used to determine the region of interest for calcium imaging analysis.

15We observed low GCaMP6s fluorescence at baseline and an increase in fluorescence in every trial where water was presented (Figure 5C–E), with no apparent desensitization across trials (data not shown). Only the ipsilateral side of the ventral nerve cord innervated by the stimulated leg showed activation (data not shown). In D. melanogaster, cells that express the ppk301 orthologue ppk28 respond to water but are inhibited by high osmolality solutions including NaCl. The population response in ppk301-expressing afferents in the mosquito is functionally different, showing robust responses to water and strong activation by salt solutions (Figure 5D–F). To determine whether ppk301 is required for the neuronal responses to water or salt, we performed imaging experiments in a ppk301 mutant background and found that the response to water is almost entirely abolished in the ppk301 mutant (Figure 5D–F). In contrast, 200 and 300 mOsm/kg NaCl solutions still elicited a strong response in the ppk301 mutant, albeit with a small reduction in amplitude (Figure 5D–F). These data show that ppk301 is required for the activation of these neurons by freshwater and that a ppk301-independent pathway activates these neurons in response to salt. This suggests that mosquito ppk301-expressing afferents are either multi-modal and each neuron responds to both water and salt, or that there is a functionally heterogeneous population of ppk301-expressing afferents with distinct neurons responding to water and salt.

16To test if ppk301-expressing neurons are activated by any solution with increased osmolality, we performed imaging experiments with two additional solutes that are not ionic salts, L-serine and D-(+)-cellobiose. We delivered all stimuli at 200 mOsm/kg, the osmolality of NaCl that elicited the peak response. We found that ppk301-expressing neurons did not respond more strongly to L-serine or D-(+)-cellobiose than they did to water alone (Figure 6A–B). Thus, activity in these neurons does not only track with osmotic pressure. Intrigued by these findings, we performed egg-laying preference assays where mosquitoes were given a choice to lay eggs on freshwater and either L-serine or D-(+)-cellobiose. Although female mosquitoes found 200 mOsm/kg NaCl highly aversive, they did not discriminate between freshwater and L-serine or D-(+)-cellobiose at 200 mOsm/kg (Figure 6C–D). Thus, the behavioral aversion to salt is unrelated to osmotic pressure.

17The observation that ppk301-expressing cells are activated by both water and salt is intriguing because wild-type females avoid laying eggs specifically in high-salt solutions. To understand how female mosquitoes interact with these different stimuli, we monitored real-time behavior of individual females offered either water or 300 mOsm/kg NaCl over 40 min by scoring their contact with liquid and individual egg-laying events. Both wild-type and ppk301 mutant mosquitoes contacted water, but only wild-type females consistently transformed these touches into egg-laying events (Figure 7A). When offered 300 mOsm/kg salt solution, both wild-type and ppk301 mutant mosquitoes touched liquid, but neither genotype reliably laid eggs (Figure 7A). These results are consistent with a model (Figure 7B) in which activation of ppk301 cells by water is a permissive signal for rapid and reliable egg-laying. Animals lacking ppk301 fail to detect the water activation signal and show delayed and intermittent egg-laying. Activation of ppk301-expressing neurons by high salt is not sufficient to drive egg-laying, suggesting that ppk301-expressing cells gate egg-laying at low NaCl concentrations, but as NaCl concentrations increase, an independent noxious salt-sensing pathway is recruited that overrides the activation of the tarsal ppk301-expressing cells imaged in this study to inhibit egg-laying (Figure 7B). We predict mutations that disrupt this noxious salt sensor would yield mosquitoes that show indiscriminate egg-laying on a high-salt substrate.

18Ae. aegypti mosquitoes preferentially lay eggs in freshwater and avoid saltwater. We annotated the ppk ion channel gene family in Ae. aegypti and made targeted mutations in several candidate genes, identifying a mutation in ppk301 that disrupts freshwater egg-laying preference and behavior. ppk301 is expressed in sensory neurons of the tarsi and proboscis, tissues that contact water during egg-laying. ppk301-expressing tarsal sensory neurons are activated by both water and high salt. This response is not driven solely by osmotic pressure, because two other solutes L-serine and D-(+)-cellobiose presented at the same osmolality were indiscriminable from water. In a ppk301 mutant background, responses to water are almost entirely abolished but responses to salt remain. Together, these data suggest a model in which activation of ppk301-expressing neurons by water is required for egg-laying while a ppk301-independent pathway encodes aversion to high concentrations of salt (Figure 7B). This study identifies an important component of the circuitry regulating egg-laying behavior and provides an entry point into understanding the most important parenting decision a female mosquito makes.

19What sensory cues and modalities activate ppk301-expressing neurons? Sensory neurons in the D. melanogaster proboscis that express the orthologous ppk28 gene are maximally activated by water but inhibited by dissolved solutes. In contrast, the afferents of the ppk301-expressing cells in the mosquito tarsi are not tuned specifically to osmolality but rather encode multimodal responses to liquid (ppk301-dependent) and to high concentrations of salt (ppk301-independent). Whether or not individual neurons within this population exhibit distinct tuning properties remains to be determined. In addition to the tarsi, ppk301 is expressed in the proboscis and pharynx. It will be important to evaluate whether these populations of ppk301-expressing cells are strictly tuned to water, as are D. melanogaster ppk28-expressing labellar sensory neurons, and lack the multimodal responses seen in the tarsal ppk301-expressing neurons.

20How does ppk301 regulate egg-laying? We favor a model in which ppk301-dependent activation of sensory neurons by liquid provides a permissive signal required for egg-laying, while high concentrations of salt activate noxious salt pathway(s) that can override this signal and prevent egg-laying. Together, these opposing signals are integrated to sculpt egg-laying preference and allow a mosquito to exploit freshwater substrates while preventing eggs from being laid on high-salt substrates that are lethal to their offspring.

21It will be interesting to discover the biophysical mechanisms by which ppk301 neurons respond to water. ppk301 encodes a single subunit of a trimeric DEG/ENaC channel. One possibility is that ppk301 ion channels are homomers that respond to osmotic pressure, similar to D. melanogaster ppk28. Alternatively, ppk301 could encode a promiscuous subunit that could be part of multiple heteromeric PPK channels with different ligands that account for some of the multimodal tuning properties seen in ppk301-expressing tarsal sensory neurons. In this scenario, genetic ablation of ppk301 could result in a novel set of PPK channels that are composed of the remaining subunits, thereby shifting the composition of channels on the membrane and influencing overall neuronal tuning properties.

22Water- and salt-sensing are critically important because all animals must regulate fluid and ion homeostasis for the proper functioning of their physiological systems. Terrestrial insects such as mosquitoes are small and have a large surface-area-to-volume ratio, meaning that they are susceptible to desiccation. Therefore, both male and female adult mosquitoes must seek out liquid for survival. It is not known if sensory systems used for determining the physical properties of liquids during fluid ingestion in male and female mosquitoes are the same as those used by the female for evaluating water quality during egg-laying. Our data show that ppk301 is expressed in both male and female appendages, and that neurons expressing ppk301 project to similar areas of the brain and ventral nerve cord. Studying the effects of ppk301 mutations on liquid ingestion in adult Ae. aegypti will provide insight into whether the same molecules and sensory neurons are being used in distinct behavioral contexts. It will also be interesting to investigate if the activity of ppk301 neurons is modulated by physiological state, including the presence of developed eggs or elevated thirst due to dehydration or desiccation stress. Previous studies have shown the existence of a canonical ‘water’ cell in the apical labral chemoreceptor sensilla of Ae. aegypti, but we do not see ppk301 expression in this tissue, indicating that there may be additional osmosensitive receptors encoded in the mosquito genome.

23A complete cellular and molecular understanding of salt sensation in mosquitoes remains to be elucidated and the ‘noxious salt sensor’ proposed in our model remains to be discovered. We note that a distributed coding of salt taste in which distinct populations of sensory neurons are modulated by salt is not unprecedented. A recent study in Drosophila reveals that in the proboscis, salt can activate or inhibit every class of gustatory receptor neuron. Salt is also a key component of blood and understanding the mechanisms of salt sensation during blood-feeding, egg-laying, and other critical mosquito behaviors is an important future goal.

24The evolution of egg-laying preference both within Ae. aegypti and in other mosquito species is a critical determinant of the types of environments and ecological niches that they are able to exploit. Indeed, some strains of Ae. aegypti have begun to exploit brackish water for egg-laying. Such an adaptation requires co-evolution of the shifting preference of females for salty water and larval tolerance of high salinity environments into which they are deposited. Investigating the underlying genetic changes that support the coordination of these shifting phenotypes in both larvae and adults will be important for understanding how Ae. aegypti adapts to novel breeding sites across the globe, which has greatly increased their capacity as a disease vector.

25The advances described here depended critically on new genetic tools we developed that did not previously exist in this non-model insect. These techniques now make it possible to visualize neuronal anatomy and activity within molecularly identified cell types and to identify the genetic and neural circuit substrates of many mosquito behaviors. These behaviors contribute to the spread of deadly pathogens and understanding their underlying biology could contribute to mosquito control efforts. The development of similar tools and reagents in other insect species of public health, agricultural, or ethological interest will broaden our view of insect biology and facilitate comparative studies of the genes and circuits underlying evolutionary adaptations in insects.

26Aedes aegypti wild-type laboratory strains (Liverpool) were maintained and reared at 25–28°C, 70–80% relative humidity with a photoperiod of 14 hr light: 10 hr dark as previously described. Adult mosquitoes were provided constant access to 10% sucrose. For routine strain maintenance, animals were blood-fed on live mice or human subjects. Adult females of all genotypes were blood-fed on a single human subject during mutant generation, for behavioral assays, and for calcium imaging. Blood-feeding procedures with live hosts were approved and monitored by The Rockefeller University Institutional Animal Care and Use Committee (IACUC protocol 15772) and Institutional Review Board, (IRB protocol LV-0652). Human subjects gave their written informed consent to participate.

27All Ae. aegypti mosquitoes used in egg-laying assays were housed in mixed-sex cages and were between 7 and 14 days old. Female mosquitoes were blood-fed by giving them direct access to a human limb introduced in or on the mesh wall of a cage. Fully engorged female mosquitoes were selected within 24 hr of blood-feeding and housed in insectary conditions with ad libitum access to 10% sucrose before being introduced into behavior assays. Unless otherwise indicated, assays were performed beginning 96 hr post-blood-meal and continuing for ~18 hr.

2810 blood-fed female mosquitoes were introduced by mouth aspiration into a standard BugDorm rearing cage (30 cm3) containing a 10% sucrose wick. Two egg-laying cups were present in each cage, each containing deionized water and a 55 mm-diameter partially submerged Whatman filter paper (Grade 1; 1001–055). In one of the cups, a metal mesh barrier placed ~1 cm above the water line prevented direct access of the mosquitoes to liquid, although the filter paper remained partially submerged and moist. Mosquitoes were allowed to lay eggs overnight (18 hr), after which the filter papers were dried and eggs counted.

29Artificial seawater was mixed according to an established recipe with lab-grade chemicals from Sigma-Aldrich. Specific dilutions were made, by volume, with deionized water. Single blood-fed females were introduced into a chamber comprised of a length of transparent acrylic tubing (inner diameter 9.525 cm) cut to 12 cm in height with a wire mesh grid glued to one end as a ceiling containing a two-sector 90 mm divided Petri dish with 10 mL of deionized water on one side and 10 mL of a specific dilution of artificial seawater on the other. As an egg-laying substrate, a 1 cm tall strip of seed germination paper (Anchor Paper; SD7615L) was wrapped around the outer diameter of each half of the Petri dish, partially submerged in the liquid. Animals were introduced by a mouth aspirator through a hole in the top of the chamber, which was then plugged with a cotton ball. Containers were stored under insectary conditions and mosquitoes were allowed to lay eggs overnight (~18 hr), after which the paper strips were dried and eggs counted.

30Wild-type mosquitoes were hatched in ‘hatch broth’ consisting of deoxygenated water containing ground Tetramin fish food. Approximately 1 day after hatching, 20 larvae were transferred into a small plastic cup containing 25 mL of a specific dilution of artificial seawater. Cups were examined each day, dead larvae removed, and ground Tetramin pellets added for food as needed. Animals successfully completing the transition to pupal stage by 8 days post-hatch were scored as surviving offspring.

31A multi-animal egg-laying assay was created out of sheet acrylic, comprising modular trays each with 14 single-animal chambers. Each chamber comprised two angled 50 mm Petri dishes each containing 2 mL of liquid and a 47 mm diameter filter paper (Whatman, Grade 1 Qualitative Filter Paper).

32We next developed a standardized imaging setup to automatically count eggs from each Petri dish. Each dish was placed onto a LED light panel (SuperbrightLEDs.com item #2020) and images were captured with a Raspberry Pi and associated camera. Images were thresholded and pixels counted for each dish of each chamber. The number of eggs corresponding to each image was determined by dividing the average pixel value of eggs determined from a manually-counted set of 20 test images. The concordance between manual counting and automatic pixel-based counting was r2 = 0.96. A parts list and schematics of the egg-laying chambers and the image acquisition and thresholding code can be found on http://github.com/VosshallLab/MatthewsYoungerVosshall2018/ (; copy archived at https://github.com/elifesciences-publications/MatthewsYoungerVosshall2018).

33For studies of the effect of NaCl on egg production (Figure 1F), each dish was filled with the same concentration of NaCl. The osmolality of each solution was measured using a Wescor model 5520 vapor pressure osmometer. Blood-fed female mosquitoes were cold anesthetized and single animals introduced into each chamber by mouth aspiration. Animals were allowed to lay for 18 hr and dishes were imaged to calculate egg numbers. For two-choice assays (Figure 3D–F), assays were performed identically, except that the two dishes contained deionized water and a NaCl solution of a specific osmolality. In Figure 6C–D, the two dishes contained deionized water and either 200mOsm/kg L-serine (Sigma S4500) or D-(+)-cellobiose (Sigma 22150). The position of each solution was varied for each chamber. Experiments were performed anonymized to genotype and data included only for those animals who laid more than 10 eggs.

34Wild-type mosquitoes were hatched in hatch broth. Approximately 1 day after hatching, 20 larvae were transferred into a small plastic cup (VWR HDPE Multipurpose Containers; H9009-662) containing 25 mL of a specific concentration of NaCl, prepared as above. Cups were examined each day, dead larvae removed, and ground Tetramin pellets added for food as needed. The number of pupae and larvae remaining alive were counted each day, and cumulative survival was calculated for these offspring.

35To measure the timing of egg-laying across days, individual blood-fed mosquitoes were introduced into egg-laying vials 48 hr after a blood-meal. Mosquitoes were transferred to a fresh vial every 24 hr and eggs from the previous day were counted and recorded. Experiments were performed anonymized to genotype.

36To measure the timing of egg-laying and liquid touching, single animals were introduced into a 50 mL cell culture flask containing 10 mL of either deionized water or 300 mOsm/kg NaCl, and a 1’ x 2’ strip of seed germination paper, partially submerged. Animals were video recorded for 40 min using a Nikon D7000 SLR with a macro lens. Four flasks were recorded simultaneously, with each set containing 1 replicate of the following conditions: wild-type, 0 mOsm/kg NaCl; wild-type, 300 mOsm/kg; ppk301, 0 mOsm/kg; ppk301, 300 mOsm/kg. Videos were manually scored for physical contact with liquid and the appearance of freshly laid eggs. Data on physical touches were recorded in 5 s intervals, with each interval scored as ‘touch’ if a single frame revealed physical contact between any appendage of the mosquito and the liquid. Videos were scored anonymized to genotype and condition.

37To identify members of the ppk gene family in Ae. aegypti and An. gambiae, we performed two complementary analyses: 1) using D. melanogaster ppk sequences as queries, we performed BLASTp against all translated protein-coding genes identified in AaegL5 (GCF_002204515.2_AaegL5.0_protein.faa) and 2) ran interproscan v5.29.68.0 against the same database of translated protein-coding genes. We took all genes that were reciprocal best hits with the D. melanogaster ppk family via blastp and were annotated by interproscan as ‘Amiloride-sensitive sodium channel.’ We repeated this analysis for the An. gambiae, PEST strain geneset downloaded from Vectorbase (Anopheles-gambiae-PEST_PEPTIDES_AgamP4.9.fa). We re-named Ae. aegypti ppk genes by giving them a three-digit identifier corresponding to their chromosomal position. The first digit represents the chromosome (1, 2, or 3), while the next two digits represent its relative position on that chromosome from the left (p) arm to the right (q) arm according to coordinates found on NCBI.

38We next built a phylogenetic tree to visualize the relationship between these genes across these three species. To do this, we selected the longest single isoform for genes predicted to encode multiple protein-coding isoforms and performed multiple sequence alignment using clustal-omega v1.2.3, including a human ASIC channel and Caenorhabditis elegans MEC4 sequence for comparison. A maximum-likelihood-estimate phylogenetic tree was constructed using PhyML v3.0 with default parameters and 100 bootstrap iterations, and manually re-rooted on MEC4 for presentation. A table of all genes and sequences incorporated in this analysis, with previous accessions, is presented in the Supplementary file 1.

39To visualize transcript abundance of each predicted ppk gene across tissues, we utilized published data. Heatmaps were generated as described and presented as log10(TPM +1) of the mean expression value for all replicates of the indicated tissue using the heatmap.2 function of the gplots v3.0.1 package in R v3.5.0 (2017).

40ppk loss-of-function alleles were generated and described previously. All new strains generated in this paper were injected into wild-type Liverpool embryos at the Insect Transformation Facility at the University of Maryland.

41PUb-mCD8:GFP-T2A-dsRed:NLS-SV40 was generated by Gibson assembly, using the following fragments: Plasmid backbone and MOS arms from a standard transformation vector (pMos-3xP3-dsRed); dsRed open reading frame amplified from the same vector by polymerase chain reaction (PCR); mCD8-GFP open reading frame PCR-amplified from a synthesized vector (Genscript); Ae. aegypti PUb promoter PCR-amplified from PSL1180-HR-PUb-ECFP (Addgene #47917). T2A and NLS sequences were added through PCR. 1000 embryos were injected with the plasmids and a Mos helper plasmid. Two stable lines were recovered with qualitatively similar expression patterns.

42ppk301-T2A-QF2 was generated through CRISPR-mediated homologous recombination into the endogenous locus. We initially attempted to use constructs with gene-specific promoter fragments to drive transgenic constructs, including the broadly expressed polyubitiquin promoter, but these either did not express at all or were expressed sporadically and mostly in non-neuronal cells. We also had no success with the Gal4/UAS system in Ae. aegypti. We therefore developed techniques to use homologous recombination to knock QF2 into the ppk301 locus.

43ppk301-T2A-QF2 was generated with a sgRNA targeting exon 2 of the ppk301 locus (ppk301-sgRNA-1, target sequence with PAM underlined: GGTTGGCAGTTGAGTCCCGG). sgRNA DNA template was prepared by annealing oligonucleotides as described. In vitro transcription was performed using HiScribe Quick T7 kit (NEB, E2050S) following the manufacturer’s directions and incubating for 2 hr at 37°C. Following transcription and DNAse treatment for 15 min at 37°C, sgRNA was purified using RNAse-free SPRI beads (Ampure RNAclean, Beckman-Coulter A63987), and eluted in Ultrapure water (Invitrogen, 10977–015).

44The donor plasmid was constructed by Gibson assembly using the following fragments: homology arms of ~1 kb on either side of the Cas9 cut site (two base pairs were deleted from the left arm immediately preceding the T2A to maintain the open reading frame); a fragment containing T2A-QF2-SV40 and 3xP3-dsRed, PCR-amplified from a vector derived from pBac-DsRed-ORCO_9kbProm-QF2 (gift of Chris Potter, Addgene #104877); a pUC57 vector backbone digested with EcoRI and HindIII. Clones were sequenced verified and midiprepped using an endotoxin free midiprep kit (Machery-Nagel) and eluted in Ultrapure nuclease-free water (Invitrogen). 2000 embryos were injected with a mixture of 300 ng/µL Cas9 protein (PNA Bio), 650 ng/µL dsDNA plasmid donor, and 40 ng/µL sgRNA. The progeny of 96 surviving G0 females were screened. Six potential founders were isolated, and one was verified to have a complete and in-frame insertion by PCR with the following primers (Forward 5’ GTGAGGGTGGTGTCGAATTAACTCTT3’, Reverse 5’GTTAGGTCAGAGGTATCCCTGAACAT3’).

4515x-QUAS-mCD8-GFP was generated from an existing plasmid (a kind gift from Chris Potter, Addgene #104878). Embryos were injected with the plasmid and a PBac helper plasmid. Two independent lines were recovered.

4615x-QUAS-dTomato-T2A-GCaMP6s was generated by Gibson assembly of the following PCR-amplified fragments: Plasmid backbone and Mos arms from PUb-mCD8:GFP-T2A-dsRed:NLS-SV40 (described above); 15x-QUAS from pBAC-ECFP-15xQUAS_TATA-SV40 (Addgene #104875, gift of Chris Potter); dTomato-T2A-GCaMP6s PCR-amplified from a vector synthesized (Genscript). Embryos were injected with the construct and a PBac helper plasmid. Two independent lines were recovered.

47Dissection of adult brains and immunostaining was modified from previously used protocols. 6–14 day-old mosquitoes were anesthetized on ice. Heads were carefully removed from the body by pinching at the neck with sharp forceps. Heads were placed in a 1.5 mL tube for fixation with 4% paraformaldehyde, 0.1 M Millonig's Phosphate Buffer (pH 7.4), 0.25% Triton X-100, and nutated for 3 hr. Brains were then dissected out of the head capsule in ice cold Ca+2-, Mg+2-free phosphate buffered saline (PBS, Lonza, 17-517Q) and transferred to a 24-well plate. All subsequent steps were done on a low-speed orbital shaker. Brains were washed in PBS containing 0.25% Triton X-100 (PBT) at room temperature six times for 15 min. Brains were permeabilized with PBS, 4% Triton X-100, 2% Normal Goat Serum for ~48 hr (two nights) at 4°C. Brains were rinsed once then washed with PBT at room temperature six times for 15 min. Primary antibodies were diluted in PBS, 0.25% Triton X-100, 2% Normal Goat Serum for ~48 hr (two nights) at 4°C. The primary antibodies used in this experiment were anti-dmBrp (mouse; 1:50: NC82, DSHB) to label the synaptic neuropil and anti-GFP (Rabbit: 1:10,000; A11122, Life Technologies). Brains were rinsed once then washed in PBT at room temperature six times for 15 min. Secondary antibodies were diluted in PBS, 0.25% Triton X-100, 2% Normal Goat Serum for ~48 hr (two nights) at 4°C. The primary antibodies used in this experiment were anti-mouse-Cy5 (1:250; Life Technologies A-10524) and anti-Rabbit-488 (1:500; Life Technologies A-11034). Brains were rinsed once then washed in PBT at room temperature six times for 15 min. Brains equilibrated overnight in Vectashield (Vector Laboratories H-1000) and were mounted in Vectashield.

48Six- to 14-day-old mosquitoes were anesthetized on ice and the bodies were carefully removed from the heads by pinching at the neck with sharp forceps. The bodies were placed in a 1.5 mL tube for fixation with 4% paraformaldehyde, 0.1M Millonig's Phosphate Buffer (pH 7.4), 0.25% Triton X-100, and nutated for 3 hr. Ventral nerve cords were dissected out of the body in ice cold PBS and transferred to a 24-well plate. All subsequent steps were the identical to the brain immunostaining protocol described above.

49ppk301>mCD8:GFP expression was visualized in brains and ventral nerve cords using a Zeiss Inverted LSM 880 laser scanning confocal with a 25x/0.8 NA immersion-corrected objective. Glycerol was used as the immersion medium to most closely match the refractive index of the mounting medium Vectashield. Brains were imaged at 2048 × 2048 pixel resolution in X and Y with 0.5 µm z-steps for a final voxel size of 0.1661 × 0.1661×0.5 µm. Ventral nerve cords were imaged at 1024 × 1946 pixel resolution in X and Y with 0.5 µm z-steps for a final voxel size of 0.3321 × 0.3321×0.5 µm ventral nerve cord images were tiled and stitched with 10% overlap. Confocal images were processed in ImageJ (NIH).

503xP3 was used as a promoter to express fluorescent markers for transgene insertion, and care was taken to distinguish 3xP3 expression from the expression of the ppk301-QF2 driver line. 3xP3 labels the optic lobes, as well as some cells in the dorsal brain. Figure 4J,K and Figure 4—figure supplement 1B,D,F,H,J were cropped to remove 3xP3 expression. In some cases, we saw projections from the optic lobes that traversed the brain. These were sometimes seen in the driver alone and effector alone controls, both of which contain a 3xP3 marker transgene. We speculate that these projections derive from cells marked by 3XP3 expression and are unrelated to ppk301 expression. These patterns of 3xP3 are worth noting, but due to the distance from the subesophageal zone and ventral nerve cord, they do not have an impact on the results of this study. In some brains, we observed faint unilateral projections from the subesophageal zone to the antennal lobe. We examined eight female brains and eight male brains for these projections and saw these projections in 5/8 brains. In males we did not see this projection in any of the eight brains examined.

51A reference Ae. aegypti brain from a 7 day old wild-type female mosquito was fixed and immunostained for Brp as described above. It was imaged as described above except with 1 μm voxels and as a tiled scan with 10% overlap. Thirty-nine brains were analyzed and the most complete and symmetric brain was chosen to serve as the template. Blind deconvolution was performed with AutoquantX3 software. The female brain was manually annotated using the segmentation and 3D reconstruction software ITK-SNAP. Regions were identified by the anatomical boundaries defined by Brp staining, and by homology to other insects, and named in accordance with revised insect brain nomenclature standards. Structures without clear boundaries were excluded. A surface mesh of each region was exported into the data analysis and visualization software ParaView, which was used to generate the 3D reconstruction shown in Figure 4H.

52The reference brain raw data and reconstruction are available on the website http://mosquitobrains.org. We have displayed this data as a brain atlas by creating an online ‘Brain Browser’ tool where users can scroll through the brain and highlight different regions. Ae. aegypti brains that are stained with the synaptic protein Brp can be warped onto this standard reference Aedes aegypti brain using the python code ClearMap. To use ClearMap, all images must be acquired with square voxels. The standard brain was imaged with 1 µm voxel size. To use it as a template, all images must either be taken at this resolution, or down sampled to a final voxel size of 1 µm. Additional channels can be warped and registered onto the reference brain, provided that one channel is imaged as described above.

53The previously characterized Ae. aegypti polyubiquitin promoter (Pub) was used to drive expression of both a membrane-bound variant of GFP (mCD8:GFP) and a nuclear localization sequence fused to dsRED by separating these genes with the T2A ribosomal skipping element. This construct was expressed in a few cells in the adult brain, as well as in larval body-wall cells. We focused our analysis on the body-wall cells because their flat and compact shape made them amenable to examining the expression of our membrane and nuclear proteins.

54Larvae were dissected by pinning the head and the tail to Sylgard plates (DowDupont) with insect pins, and a long longitudinal cut was made along the dorsal surface of the body wall. The body wall was filleted open with four additional insect pins, and the organs were removed. The animals were fixed for 25 min in 4% paraformaldehyde, 0.1 M Millonig's Phosphate Buffer (pH 7.4), 0.25% Triton X-100 at room temperature, and then rinsed 3 times in PBS. Larvae were transferred to a 1.5 mL tube and washed with PBT 6 times for 15 min while nutating at room temperature. Larvae were then incubated in Vectashield with DAPI overnight and mounted in Vectashield for imaging. Larvae were imaged on a Zeiss Inverted LSM 880 laser scanning confocal with a 40X/1.2 NA oil immersion objective. The cells were imaged at a resolution of 2048 × 2048 pixels in a single confocal slice for a pixel size of 0.0692 × 0.0692 µm. Images were processed in ImageJ (NIH).

55To visualize sensory neuron cell bodies in ppk301-T2A-QF2, 15xQUAS-dTomato-T2A-GCaMP6 animals we dissected live sensory tissues using fine forceps, dipped in cold methanol for ~5 s, and mounted on a slide in glycerol. Appendages were viewed on a Zeiss Inverted LSM 880 laser scanning confocal with a 25x/0.8 NA immersion corrected objective at a resolution of 1024 × 1024 pixels and a voxel size of 0.2076 µm x 0.2076 µm x 1 µm.

56Calcium imaging was performed on an Ultima IV two-photon laser-scanning microscope (Bruker Nanosystems) equipped with galvanometers and illuminated by a Chameleon Ultra II Ti:Sapphire laser (Coherent). GaAsP photomultiplier tubes (Hamamatsu) were used to collect emitted fluorescence. Images were acquired with a 60X/1.0N.A. Long Working Distance Water-Immersion Objective (Olympus) at a resolution of 256 × 256 pixels.

57Calcium imaging experiments were performed on female mosquitoes that were 7–11 days post-eclosion. Mosquitoes were fed a human-blood-meal 96–108 hr prior to imaging and were not giving access to an egg laying substrate so that they were gravid at the time of imaging. Gravid females were anesthetized at 4°C for dissection. The wings were removed and the mosquito was fixed to a custom Delrin plastic holder with UV-curable glue (Bondic). The mosquito was inserted into a hole in the holder, such that the ventral thorax, including all coxae, were exposed above the surface of the holder, with the rest of the mosquito below. The mosquito was secured with a few points of glue (Bondic) on the abdomen, thorax and head. The leg that was presented with water remained free of glue to prevent damage to the tissue. Once the mosquito was secured to the plate, one of the forelegs was inserted into a small diameter tube that was secured to the bottom of the plate and could later be attached to the fluidics apparatus used for stimulus delivery (described below). The top of the dish was then filled with external saline. The recipe we used is based D. melanogaster imaging saline:103 mM NaCl, 3 mM KCl, 5 mM 2-[Tris(hydroxymethyl)methyl]−2-aminoethanesulfonic acid (TES), 1.5 mM CaCl2, 4 mM MgCl2, 26 mM NaHCO3, 1 mM NaH2PO4, 10 mM trehalose, 10 mM glucose, pH 7.3, osmolality adjusted to 275 mOsm/kg). The coxae were gently spread from the midline and secured in dental wax. The cuticle was removed above the prothoracic ganglia using very sharp forceps. Opaque non-neural tissue, primarily fat cells and muscle, was removed if they obstructed the ventral nerve cord. Great care was taken not to damage the ppk301-expressing nerves running from the legs into the ventral nerve cord. These run up the posterior-ventral region of the leg and are extremely superficial. dTomato fluorescence was examined before imaging to verify that the nerves were intact. If an animal did not respond to water, 200 mOsm/kg, or 300 mOsm/kg NaCl it was discarded.

58The preparation was secured to the stage using a custom laser cut acrylic holder. A single plane through the center of the prothoracic neuropil was scanned at 4.22 fps with a 920 nm excitation wavelength imaged through a 680 nm shortpass infrared (IR) blocking filter, a 565 nm longpass dichroic and 595/50 nm or 525/70 nm bandpass filters. GCaMP6s and dTomato emission was collected simultaneously for 70 frames per trial. Each concentration was delivered at least three times per animal, and each animal was exposed to a series of either 0, 200, and 300 mOsm/kg NaCl, or 200 mOsm/kg NaCl, 200 mOsm/kg L-serine, 200 mOsm/kg D-(+)-cellobiose and freshwater. All wild-type and PPK301 mutant animals were reared and imaged in parallel.

59Imaging remained stable during the duration of the imaging session in all animals that were included in this study. We did not notice a decrease in the response to stimuli over time. Before beginning the experiments using multiple concentrations of salt, we imaged animals with repeated water delivery, and saw no desensitization to the response to water over 10 presentations (data not shown).

60Liquids were delivered to a single foreleg of the mosquito using a custom built low-volume fluidics device. Piezoelectric diaphragm micropumps and their controller (Servoflo) were run by an Arduino using a code written for this purpose. A custom manifold was milled for small volume liquid delivery. The mosquito was illuminated with an IR light and liquid delivery was monitored using an IR camera. The liquid coated the tarsal and tibial segments and was retracted immediately after imaging each sweep. We waited at least 1 min between each trial. We only observed responses in the prothoracic region ipsilateral to the stimulus delivery.

61All image processing was done using FIJI/ImageJ (NIH). Further processing was done using Excel and Prism (GraphPad). Regions of interest were selected based on the dTomato fluorescence intensity and used for analysis of GCaMP6s signal. All traces with motion, as determined by dTomato fluorescence instability, were discarded. A Gaussian blur with a sigma value of 1 was performed on the GCaMP6s signal. In the calculation of ΔF/F, six frames were averaged before stimulus presentation to determine the baseline fluorescence. To determine Fmax, the average of 3 frames at the peak after stimulus delivery was determined for each sweep.

62All statistical analyses were performed using Prism (GraphPad) or R version 3.5.0. Data collected as percentage of total are shown as median with interquartile range and data collected as raw value are shown as mean ± SEM or mean ± SD. Details of statistical methods are reported in the figure legends.

63All plotted data (with the exception of raw video files) are available in Supplementary file 1, and behavior assay schematics and egg-laying counting image analysis scripts can be found at https://github.com/VosshallLab/MatthewsYoungerVosshall2018. (; copy archived at https://github.com/elifesciences-publications/MatthewsYoungerVosshall2018). Plasmids will be made available from Addgene.