Cardiogenic control of affective behavioural state

1Interoceptive processing of visceral physiological signals, such as cardiac palpitations or stomach fullness, is crucial for maintaining homeostasis–. Diverse psychiatric conditions, such as anxiety disorders, panic disorder, body dysmorphic disorders and addiction, have been hypothesized to be related to dysregulation of interoceptive monitoring by the brain,, and can be statistically correlated with specific visceral organ dysfunction. For example, patients with panic disorder and agoraphobia are more likely to have mitral valve prolapse or clinical symptoms similar to paroxysmal supraventricular tachycardia,. Modern correlative studies have further suggested links between cardiac changes and affect regulation,, including correlations between cardiac interoception with anxiety and functional alterations in the insular cortex, a cortical region that has a central role in both the processing of physiological signals and the regulation of emotions,. However, determining whether primary physiological signals such as increased heart rate can causally influence behavioural states, as proposed in classical physiological theories of emotion, has—although widely debated—remained largely experimentally intractable. Available nonspecific interventions that might disrupt cardiac signals (such as electrical vagus nerve stimulation) are well known to also induce numerous physiological changes that would be unwanted in this context, including direct suppression of respiratory and heart rates as well as anxiolytic and antidepressive effects–, giving rise to multiple direct confounds for the question explored here. Other nonspecific interventions to alter cardiac rhythms, such as broadly active pharmacological stimulants or electrical pacemakers, also introduce insuperable confounds through initial actions beyond the direct pacing of cardiomyocytes, and thus lack the necessary precision. Studying the key question of how cardiac physiology regulates emotional states has remained inaccessible, and the effects on behaviour remain unknown.

2Precise modulation of electrochemical signals in the heart and other peripheral organs in vivo would enable fundamental studies of physiology and interoceptive signalling–, but stimulation methods that operate with high spatial and temporal precision in highly dynamic environments such as the beating heart– are limited. Electrical pacemakers require invasive surgical implantation to deliver local indiscriminate stimulation that lacks cell-type specificity–. Optogenetics might in principle facilitate cardiomyocyte-specific control with high spatial and temporal precision, but existing optogenetic methods have been limited to acute demonstrations that require exposure or even excision of the heart to deliver light–, all of which are incompatible with freely moving studies of behaviour. Thus far, to our knowledge, no study beyond the brain has achieved precise and noninvasive organ-level control of behavioural or physiological function. Establishing noninvasive approaches to manipulate physiology with cell-type specificity would enable long-sought functional studies of signals that arise from cells across the organism, and reveal the causal influences of these cells on brain function and behaviour.

3Conventional microbial opsins have not been sensitive enough to control a large organ such as the heart with the requisite power to facilitate behavioural studies within intact animals–, but the discovery of the highly sensitive and red-shifted pump-like channelrhodopsin ChRmine led us to consider the potential for noninvasive optogenetic control of deep tissue with minimal irradiance. We previously found that ChRmine enabled neuromodulation of deep brain circuits without intracranial surgery, which raised the possibility that this optogenetic tool might be broadly applicable to modulating biological processes across the entire body of large organisms such as mammals. Specifically, we hypothesized that ChRmine might allow on-demand deep-tissue control of cardiac pacing when targeted to cardiomyocytes without the need for direct exposure of the heart,.

4We first achieved cardiomyocyte-restricted expression by placing the ChRmine transgene under the control of the mouse cardiac troponin T promoter (mTNT), using the AAV9 serotype, which exhibits tropism for cardiac tissue,. Infection of cultured primary cardiomyocytes with AAV9-mTNT::ChRmine-2A-oScarlet enabled light-evoked contractions with irradiance as low as 0.1 mW mm−2, consistent with the photosensitivity of ChRmine in neurons (Extended Data Fig. 1 and Supplementary Video 1).

5We next determined whether systemic viral gene delivery of ChRmine, despite the lower multiplicity of infection compared with transduction by direct local injection,, could allow noninvasive control of heart rhythms in wild-type mice. Retro-orbital injection of AAV9 enabled restricted expression of ChRmine in cardiomyocytes throughout the heart, with homogeneous expression in both ventricular and atrial walls and no off-target expression in other cardiac cell types (fibroblasts and neuronal ganglia) or in other organs (Fig. 1a,b and Extended Data Fig. 2). When pulsed 589-nm light was delivered through intact skin overlying the thorax of anaesthetized mice, we observed robust photoactivation of cardiac QRS complexes within a safe range of irradiance comparable to that used for transcranial optogenetics (Fig. 1c,d). Reliable cardiac rhythms were induced at even supraphysiological rates of up to 900 beats per minute (bpm), within the photophysical properties of ChRmine, with an immediate return to naturally paced sinus rhythm upon the cessation of light (Fig. 1e–g). This approach was not able to decrease heart rate below baseline levels, but afforded spatial control of cardiac rhythms by evoking either right or left ventricular pacing depending on the placement of the laser (Extended Data Fig. 3a–i).

6To translate this approach to mouse behaviour, we mounted a 591-nm micro-LED onto a wearable fabric vest to deliver light through intact skin overlying the chest wall (Fig. 2a and Extended Data Fig. 4a,b). This integration of a molecular tool with accessible electronics enabled the initial demonstration of noninvasive and sustained ventricular pacing at experimenter-defined rhythms suitable for most behavioural assays in freely moving mice (Extended Data Fig. 4).

7To test whether heart rhythms directly set by this optical pacemaker could influence behaviour, we optogenetically induced intermittent ventricular tachycardia (900 bpm for 500 ms every 1,500 ms) to mimic non-sustained arrhythmias that are observed during stressful contexts–, while shortening the duration of decreases in systolic blood pressure and avoiding incidental heating from light-delivery devices (Fig. 2b and Extended Data Figs. 3j–m and 4c). We first assessed the appetitive or aversive effects of optical pacing using a real-time place-preference (RTPP) assay (Fig. 2c). Mice spent an equal proportion of time on the paced and non-paced sides of the two-chamber arena, and showed no difference in locomotion compared to littermate controls—revealing that optically induced intermittent tachycardia was not intrinsically aversive and did not cause locomotor impairment (Fig. 2d,e). Optical pacing also did not modulate pain perception during a hot-plate test, with paced mice exhibiting comparable behavioural responses to control mice (Extended Data Fig. 5a–c).

8By contrast, when we tested for anxiety-related behaviour using an elevated plus maze (EPM) assay, the same mice exhibited limited exploration of the open (exposed) arms of the apparatus after optical pacing, compared to control mice, preferring to remain within the protected areas of the closed arms (Fig. 2f,g). Paced mice also avoided the centre area during an open field test (OFT) (Fig. 2h,i). We observed no effects from illumination alone in control (opsin-negative) mice, and baseline anxiety levels between control and virally transduced groups were similar (Extended Data Fig. 5d–h). Increased anxiety-like behaviour induced by optical pacing during the EPM and OFT assays was similarly observed in female cohorts (Extended Data Fig. 5i–l). We found that mice that received intermittent cardiac pacing within baseline ranges (660 bpm) rather than elevated (900 bpm) ranges did not exhibit behavioural differences compared to control mice during the EPM or OFT (Extended Data Fig. 5m–p). Because continuous ventricular pacing can have a long-lasting effect on animal health,, we also assessed for potential changes in baseline anxiety levels and mobility in mice that were subjected to longer-term treatments of intermittent tachycardia (one-hour sessions every other day for two weeks) and did not observe locomotor or behavioural differences in these mice when compared to control mice during the EPM and OFT (Extended Data Fig. 5q–u).

9We further investigated whether this context-dependent enhancement of anxiety-related behaviour could translate to a classical operant task, by using a trial-based variation of the Vogel conflict task in which water-restricted mice show willingness to seek a water reward even when the reward is coupled to a risk of mild shock (Fig. 2j). Mice that received cardiac pacing performed similarly to control littermates when allowed to freely press for water with no delivery of the aversive stimulus (Fig. 2k–n). However, when random shocks were introduced in 10% of trials, optically paced mice were found to suppress or terminate water-seeking altogether (Fig. 2l,m). These mice exhibited increased apprehension, as revealed both by an overall decreased lever-pressing rate and by an increased time to the next subsequent lever press after a shock trial—consistent with the heightened levels of anxiety that were observed during the EPM and OFT (Fig. 2m,n). By contrast, control mice exhibited reduced water-seeking only when the frequency of shock trials was increased to 30% (Extended Data Fig. 6). This context-dependent influence of cardiac pacing on anxiety-like behaviour suggested that higher-order brain function was involved in the processing of interoceptive cues.

10We therefore next used the optical pacemaker to identify potential neural correlates and mechanisms of this observed behaviour along the heart–brain axis. First, transgenic TRAP2 mice, in which neurons with increased expression of the immediate early gene Fos can be labelled with tdTomato as a marker for neural activation, were used to perform a brain-wide screen to identify regions that were affected by optical pacing (Fig. 3a,b and Extended Data Fig. 7). Whole-brain tissue clearing, registration to a reference brain atlas and automated cell counting together revealed that a number of brain regions exhibited increased expression of tdTomato in optically paced mice. These included areas associated with the central autonomic network,, such as the insular cortex (including its visceral area (VISC), gustatory area (GU) and agranular insular area (AI)), prefrontal cortex (including the infralimbic area (ILA), prelimbic area (PL) and anterior cingulate area (ACA)) and brainstem (including the pons (P) and medulla (MY)) (Fig. 3b). Meanwhile, pointing to specificity, many other cortical regions that are not known to be involved in autonomic or interoceptive processing were not significantly activated, including primary sensory auditory (AUD) and visual (VIS) cortical areas, as well as the cerebellar vermis (VERM) and cerebellar nuclei (CBN) (Fig. 3b). Consistent with the TRAP2 mapping results, optical pacing similarly increased the endogenous expression of Fos mRNA in the posterior insular cortex (pIC) and in the brainstem (Fig. 3c and Extended Data Fig. 8). In particular, sensory relay circuits of the nucleus tractus solitarius (NTS), as well as noradrenergic neurons in the locus coeruleus (LC), which are involved in arousal and stress, also exhibited prominent Fos labelling (Extended Data Fig. 8).

11We next investigated the cardiac-pacing-induced neural dynamics at single-neuron resolution using in vivo electrophysiology in awake mice (Fig. 3d–h). On the basis of the observed increased Fos expression in the pIC after cardiac pacing, and because the insular cortex is a key cortical hub for interoception, we used four-shank Neuropixels 2.0 probes to obtain rich multi-regional recordings of the pIC and surrounding regions (Fig. 3d,e). Notably, we observed pacing-evoked increases in insular activity at both the single-unit and population levels (Fig. 3f,g), whereby pIC neurons were acutely activated by cardiac stimulation with heterogeneous temporal dynamics and returned to basal levels of activity after pacing offset. By contrast, no significant changes in activity were recorded in control mice during photostimulation, ruling out potential light- or heat-induced representations in this region (Fig. 3g). We also observed a substantial diversity in temporal dynamics triggered by pacing in other recorded regions, including acute responses in the somatosensory cortex and delayed responses in the striatum during stimulation offset (Fig. 3h). Our data show that the pIC and other regions of the central autonomic network are distinctly engaged by optically evoked tachycardia,, and are in line with human neuroimaging studies that have correlated these brain areas with cardiac interoception–.

12To determine whether the anxiogenic circuitry recruited by cardiac pacing could be specifically modulated to influence behaviour, we next performed optogenetic inhibition with the 473 nm (blue light)-activated inhibitory channelrhodopsin iC++. We targeted the pIC (with well-established roles in both processing and regulating cardiac sensory signals and anxiety-related behaviours–) and the medial prefrontal cortex (mPFC) (crucially involved in reward and aversion processing, as well as associated with cardiovascular arousal). To perform simultaneous optogenetic inhibition of the cortex and optically paced tachycardia, we bilaterally injected AAVdj-hSyn::iC++-eYFP or AAVdj-hSyn::eYFP control virus and implanted fibre-optic cannulas into the pIC or mPFC of mice expressing ChRmine in the heart (Fig. 4a). As expected, in eYFP-expressing control mice, we found that 473-nm illumination of the pIC did not affect the reduction of water-seeking by optical pacing in trials with a risk of shock (Fig. 4b,c). By contrast, the same intervention in mice expressing iC++ instead of eYFP alone in pIC did reverse the reduction of water-seeking (Fig. 4d–g); all mice receiving pIC inhibition completed the water-retrieving task and exhibited decreased apprehension, with the time to next lever press after shock reduced to near baseline levels (Fig. 4g). Similarly, iC++ inhibition increased open-arm exploration time during the EPM assay in optically paced mice relative to eYFP controls (Fig. 4h).

13The attenuation of the anxiogenic effect of optical pacing exhibited specificity to pIC inhibition; inhibition of the mPFC did not decrease cardiac-associated anxiogenic behaviours relative to eYFP controls (Fig. 4i–n). To test for any direct anxiolysis from optogenetic inhibition of the pIC (that is, not through modulation of the cardiac-pacing effect), we performed the EPM assay and the lever-pressing task in the absence of cardiac pacing and with 30% shock trials to allow the detection of pacing-independent apprehensive behaviour (Extended Data Fig. 9a–d). Inhibition of the pIC without cardiac pacing did not increase open-arm exploration, affect lever-press suppression or influence heart rate (Extended Data Fig. 9). Thus, pIC inhibition alone appeared to be insufficient to induce anxiolysis, consistent with previous reports. Together, these results are in line with a model in which the pIC is important for mediating the anxiety-related and apprehensive behaviours that arise from direct cardiac pacing.

14In this study, we have developed a method for noninvasive optogenetic control of specific cardiac rhythms during active behaviour. We show that the optically induced tachycardia was not intrinsically aversive, but rather elicited anxiety-like behaviours and apprehension in potentially risky environments. Although diverse mechanisms may contribute to this effect, we consider that anxiogenic effects of evoked tachycardia are not likely to be mediated through a reduction in blood pressure, as drugs that reduce systolic blood pressure tend to be anxiolytic (for example, propranolol and clonidine) or neutral (for example, Ca2+-channel blockers). Our observation of anxiogenesis in response to increased heart rates (900 bpm or 15 Hz) is in line with clinical observations that accelerated heart rates—but not other forms of altered haemodynamics (for example, increased heart rate variability)—are associated with panic and other anxiety-related disorders,. The altered rate, rather than the external nature of cardiac contraction timing, appears to be important; for example, we found that intermittent or asynchronous stimulation close to baseline heart rates at 660 bpm (11 Hz) did not result in anxiety-like behaviour.

15In further investigations of the mechanisms that underlie these behaviours, we found that optogenetic pacing activated the pIC, consistent with studies of cardiovascular control in anaesthetized rodents and neuroimaging studies of cardiac interoception and reflex control in humans–, including in the setting of panic and anxiety,. It remains unclear whether this pathway can be modulated by peripheral baroreceptive sensory neurons or other sensory mechanisms that detect changes in blood pressure–, and it is possible that there are additional ways in which cardiac viscerosensory information can be relayed to higher cortical areas,. The anxiogenic behavioural effects of cardiac pacing were attenuated during optogenetic inhibition of the pIC, suggesting that the insula has a causal role in integrating sensory information from the heart with a contextual assessment of environmental risk to produce adaptive behavioural patterns. Our findings support the idea that the insular cortex is involved in monitoring not only consummatory– but also entirely internal interoceptive states to instruct relevant behavioural responses, as predicted from human neuroimaging studies of cardiac interoception–.

16This study shows that cell-type-specific, temporally precise, noninvasive perturbation of organ-scale physiology is possible in fully intact, freely behaving mammals. Although we have applied our approach mainly to study animal behaviour over a period of minutes, future integration with miniaturized wireless devices may facilitate longer-term studies to modulate targeted populations of cells over days to weeks while alleviating the need for intimate contact with the light source. Furthermore, refinement in cell-type-targeting strategies may enable minimally invasive to noninvasive optogenetic dissection of specific cell types (for example, pacemaker cells, Purkinje fibres and cardiac ganglions) to determine their effects on regulating cardiac electrophysiology and behaviour. Finally, our approach, which requires no specialized optoelectronics or surgery, has the potential for broad application to a range of physiological systems throughout the body—opening up numerous opportunities to explore the complex interactions between physiological systems in health, disease and treatment.

17All animal procedures followed animal care guidelines approved by Stanford University’s Administrative Panel on Laboratory Animal Care (APLAC) and guidelines of the National Institutes of Health. Investigators were not blinded to the genotypes of the mice. Male and female wild-type C57BL6/J (JAX 0064) mice were used for most behavioural experiments unless specified otherwise, and all mice were 8–12 weeks old at the time of starting behavioural experiments. Mice were housed in plastic cages with disposable bedding on a standard light cycle with food and water available ad libitum, except when placed on water restriction. When on water restriction, mice were provided with 1 ml of water each day and maintained above 85% of baseline weight. Behavioural experiments were performed during the dark phase.

18A 685-bp fragment containing the promoter region of the mouse troponin gene was amplified from a wild-type mouse using CGCACGCGTGAGGCCATTTGGCTCATGAGAAGC and CATGGATCCTCTAGAAAGGGCCATGGATTTCCTG primers, cloned upstream of ChRmine-p2A-oScarlet using MluI and BamHI sites in an AAV backbone, sequence-verified and tested for expression in dissociated neonatal cardiomyocytes.

19Dissociated neonatal mouse cardiomyocytes prepared using the Pierce Isolation Kit (Thermo Fisher Scientific, 88289) were transfected with rAAV-mTNT::ChRmine-p2A-oScarlet (1 µl of 8 × 12 viral genomes (vg) per ml in 500 µl of medium). Three to five days after infection, individual cardiomyocytes were identified under a light microscope. Optical stimulation was provided by a Spectra X Light engine at 585 nm (LumenCore) coupled to a Leica DM LFSA microscope and synchronized with video recording at 100 fps using LabView software. Laser power leaving the imaging objective was measured with an optical power meter (Thorlabs PM100D). Videos were analysed for contraction using custom scripts in MATLAB.

20Wild-type mice aged three to four weeks were anaesthetized with isoflurane and rAAV-mTNT::ChRmine-p2A-oScarlet (2 ×1011 vg per mouse) or vehicle was delivered by retro-orbital injection. Our selected titres were previously used for systemic viral transduction of ChR2 in the heart. A total volume of 60 µl 0.9% NaCl saline solution was injected into the right retro-orbital sinus using a 28G needle, then allowed to recover on a warming pad before being returned to the home cage.

21Mice were tested three weeks after injection of the pacemaker virus. Electrocardiography signals were collected using commercial instruments (Rodent Surgical Monitor+, Indus Instruments), with anaesthetized mice placed in a supine position and limbs placed in contact with electrode pads via a conductive gel. A 594-nm laser (LaserGlow) was attached to a fibre-optic patch cord (Thorlabs) terminating in a 200-µm-diameter, 0.39-NA fibre (Thorlabs) which was positioned against the chest. Optical power was adjusted using the laser’s built-in power modulator and measured with an optical power meter (Thorlabs) at the fibre tip. Stimulation was performed with a pulse width of 10 ms and an inter-pulse interval ranging from 120 ms (equivalent to 500 bpm) to 67 ms (900 bpm), controlled by a TTL signal generator (Master-8). Heart rate (bpm) was derived from the heart rate interval between successive R waves (RR interval) obtained from ECG recordings. Fidelity of photoactivated QRS complexes was quantified by counting the number of beats at a set frequency divided by the number of total beats measured during the middle 20 s of a 30-s stimulation period.

22Mice were anaesthetized (1.5–2% isofluorane) and placed in the supine position with the chest shaved. Systolic blood pressure measurements were performed using a 1.4-F pressure sensor mounted Millar catheter (SPR-671, ADInstruments) and recorded using LabChart 7 Pro (ADInstruments). The catheter was inserted via the right carotid artery into the left ventricle. A 589-nm laser was used to deliver 240 mW mm−2 light across intact chest at either constant or intermittent (500 ms ON, 1,500 ms OFF) optical stimulation at 900 bpm with a 10-ms pulse width for 30 s to assess optogenetic pacing effects on systolic blood pressure in real time.

23Custom-made wearable optical stimulators were constructed using 3 × 4.5 mm 591-nm PC Amber Rebel LEDs (Luxeon LXM2-PL01-0000). 30AWG flexible silicone wire (Striveday) was soldered to the LED pad and coated with electrically insulating, thermally conductive epoxy (Arctic Alumina), and adhered to copper sheet cut to 10 × 15 mm for thermal dissipation and subsequently glued to a fabric vest designed for freely moving mouse behaviour (Coulbourn A71-21M25). Wiring was held in place on the vest using hot glue and the free ends were inserted into a breadboard for stimulus control by an LED Driver (Thorlabs LEDD1B T-Cube). The optical power was set to 160–240 mW mm−2 measured from the surface of the LED. Light was delivered at intervals consisting of a 10-ms pulse width at 15 Hz (900 bpm) for 500 ms with 1,500 ms OFF time by using either a Master-8 or an Arduino microcontroller synchronized to behaviour recording software. Computer-aided design schematics were created with Onshape. Thermal measurements were performed using a FLIR C2 Compact thermal camera (FLIR) and the thermal profile at the surface of the micro-LED is plotted in Extended Data Fig. 4c.

24All mice were habituated to the experimenter and handled for at least three days, and in addition allowed to acclimatize to wearing optical pacemaker hardware for at least five days, before behavioural experiments. Fur over the chest was removed (Nair) at least five days before behavioural experiments. Mice were briefly anaesthetized with isoflurane before the placement of the optical pacing vest and allowed to fully recover in the home cage (at least 1 h) before experiments. We used a stimulation protocol consisting of a 10-ms pulse width at 15 Hz (900 bpm) with 500 ms ON time and 1,500 ms OFF time to introduce intermittent tachycardia or 10-ms pulse width at 11 Hz (660 bpm) with a Poisson distribution to introduce increased heart rate variability. Mice received optical stimulation during the ON periods of the behavioural assay from the wearable micro-LED device in both control and ChRmine cohorts. No statistical difference in behaviour was observed between virally transduced and control groups at baseline, suggesting that there were no side effects from transgene delivery. No statistical difference in behaviour was observed in control groups before, during and after optical stimulation, suggesting that there were no effects from light delivery alone.

25Mice were placed in a custom-built RTPP chamber (30.5 × 70 cm) on day 1 to determine their baseline preference for each side of the chamber. Behavioural tracking was performed using blinded automated software (Noldus Ethovision). On day 2, mice were stimulated whenever they were on one side of the chamber. Stimulation sides were randomly assigned and counterbalanced across mice. Each session lasted 20 min.

26The EPM was made of grey plastic (Med Associates). Mice were gently placed in the closed arm of the EPM. Mice were allowed to freely explore the maze for a 5-min baseline ‘off’ period, followed by a 5-min ‘on’ period during which optical stimulation was delivered, and finally a 5-min ‘off’ period. Behavioural tracking was performed using blinded automated software (Noldus Ethovision) and the overall time spent in open arms was reported for each epoch.

27Mice were placed in a 60 × 60-cm arena and allowed to freely explore during a 9-min session. Optical stimulation was delivered during the middle 3-min epoch. Movement was tracked with a video camera positioned above the arena. To assess anxiety-related behaviour, the chamber was divided into a peripheral and centre (48 × 48 cm) region.

28Water-restricted mice were trained to lever press for a small water reward (around 10 μl water) while freely moving in an operant condition box containing a single retractable lever and a shock grid floor (Coulbourn). Mice were allowed to retrieve a maximum of 50 rewards per day, and sessions were terminated after all rewards had been retrieved or after 30 min. After each lever press, the lever was retracted for 5 s before extending again. After mice retrieved 50 rewards for at least 3 consecutive days (typically 2–3 weeks of training), they were allowed to proceed with stimulation experiments. On shock days, mice were given a 1-s, 0.1-mA foot shock after 10% of lever presses instead of water. Shocks were delivered in a pseudorandom order on lever-press trials 5, 13, 24, 31 and 44, and the time to the next lever press was measured from the time elapsed for these trials until the subsequent lever press. During stimulation experiments (both baseline and shock days), optical stimulation was delivered throughout the experiment. Water was delivered using a custom set-up consisting of a lick spout (Popper and Sons, stainless steel 18-gauge) and a solenoid (Valcor, SV74P61T1) controlled by a microcontroller (Arduino Uno R3). Licking was monitored using a capacitive sensing board (Arduino Tinker Kit) wired to the lick spout and interfacing with the microcontroller. Shocks were delivered using an 8-pole scrambled shock floor (Coulbourn). Behavioural stimuli—lever presentations and retractions, and shocks—were controlled with Coulbourn Graphic State software. The timing of lever presses and licks was also recorded at 5 kHz using a data-acquisition hardware (National Instruments, NI PCIe-6343-X).

29Fos2A-iCreER (TRAP2; JAX 030323) mice were backcrossed onto a C57BL6/J background and bred with B6;129S6-Gt(ROSA)26Sortm14(CAG-tdTomato)/Hze/J (Ai14; JAX 007908) mice, as previously described. Both male and female mice were used for TRAP2 labelling experiments. Mice were injected retro-orbitally with rAAV9-mTNT-ChRmine-oScarlet or a vehicle control at three to four weeks of age. Four weeks later, mice were handled and acclimatized to fresh clean cages and optical pacing equipment for at least seven days before labelling. On the day of labelling, mice were allowed to acclimatize to optical pacing equipment for at least 2 h in a fresh clean cage with food and water, stimulated for 15 min (10-ms pulse width at 15 Hz for 500 ms every 1,500 ms) and left undisturbed for 2 h, at which time they were injected intraperitoneally with 5 mg kg−1 4-hydroxytamoxifen (Sigma) dissolved in normal saline containing 1% Tween-80 and 2.5% DMSO (as described previously,). Mice were then returned to their home cage and were euthanized at least two weeks later to allow for full expression of the fluorophore.

30Mice were perfused with ice-cold phosphate-buffered saline (PBS) and 4% paraformaldehyde (PFA), then post-fixed in a 1% CLARITY hydrogel solution (1% acrylamide, 0.003125% bis-acrylamide, 4% PFA and 0.25% VA-044 in 1× PBS) for 2 days. Tissue was degassed, polymerized at 37 °C for 4 h and washed with 200 mM sodium borate with 4% sodium dodecyl sulfate solution overnight. Tissue was then electrophoretically cleared for 3–7 days at 80 V (Life Canvas), passively cleared for an additional 2 days, then washed in PBS containing 0.2% Triton-X and 0.02% sodium azide at least 6 times at 37 °C. Cleared samples were refractive-index-matched using RapiClear (Sunjin Labs) and imaged on a custom-built light-sheet microscope using a 10× objective and 5-µm step size or an LaVision Ultramicroscope with a 0.63× zoom macro lens with a step size of 5 µm. Images were visualized using Vision4D (Arivis).

31For automated whole-brain registration and cell-segmentation analysis, images were loaded onto Arivis Vision4D software, and neurons were segmented using a built-in supervised pixel-based classifier package based on Ilastik (‘Trainable Segmenter’). Segmentation masks were converted to binary cell masks. Raw light-sheet microscopes images and cell masks were registered to a common reference space defined by the Allen Institute’s Reference Atlas and analysed in a region-based manner using our MIRACL package.

32Mice were injected retro-orbitally with AAV9-mTNT-ChRmine-oScarlet or vehicle at three to four weeks of age. At four weeks after injection, mice were handled and acclimatized to fresh clean cages and optical-pacing equipment for a minimum of seven days before pacing experiments. On the day of labelling, mice were allowed to acclimatize to optical-pacing equipment for at least 2 h in a fresh clean cage with food and water, stimulated for 15 min and euthanized 30 min after stimulation by perfusion with ice-cold PBS and 4% PFA under heavy anaesthesia. Tissue was post-fixed in 4% PFA on ice for an additional 24 h (brain) before staining and imaging.

33Post-fixed brains were cut with a vibratome into 65-µm coronal slices. Heart and other organs were sliced at 200-µm thickness. Tissue slices were stored in 70% ethanol at −20 °C. Established protocols for third-generation hairpin chain reaction (HCR) in situ hybridization were used for coronal slice. In situ hybridization probes (ChRmine, Fos and Slc6a2) were designed by and purchased from Molecular Instruments. Hybridization was performed overnight in hybridization buffer (Molecular Instruments) at 4 nM probe concentration. The next day, slices were washed (three times in wash buffer at 37 °C then twice in 2× SSCT at room temperature; 30 min each) and then incubated in amplification buffer. Dye-conjugated hairpins (B1-647, B3-488 and B5-546) were heated to 95 °C for 1 min and then cooled to 4 °C. Hairpin amplification was performed by incubating individual slices in 50 µl of amplification buffer with B1, B3 and B5 probes at concentrations of 240 nM overnight in the dark. Samples were stained with DAPI, washed three times with 5× SSCT for 30 min each and then equilibrated in exPROTOS (125 g iohexol, 3 g diatrizoic acid and 5 g N-methyl-d-glucamine dissolved in 100 ml deionized water with the refractive index adjusted to 1.458) (ref. ), a high-refractive-index mounting solution, then imaged. Slices were imaged on a confocal microscope (Olympus FV3000).

34At 48 h post-fixation, hearts were sectioned into 200-µm slices. For staining, slices were first incubated for 10 min in blocking solution (3% normal donkey serum (NDS) in PBST), followed by primary antibody staining overnight at 4 °C using the following antibodies: anti-vimentin (ab24525), anti-cardiac troponin I (ab188877) or anti-PGP9.5 (ab108986), purchased from Abcam at 1:200 dilution in blocking solution. Slices were then washed twice in PBST, then stained with secondary antibodies (1 mg ml−1) at 1:500 dilution for 3 h at room temperature using the following: F(ab’)2 anti-chicken 488 (703-546-155) and anti-rabbit 647 (711-606-152) purchased from Jackson ImmunoResearch Laboratories. The slices were then stained with DAPI and washed three times with PBST (30 min per wash). Sections were mounted onto slides and mounted with exPROTOS. Slices were imaged on a confocal microscope (Olympus FV3000).

35For all surgeries, mice were anesthetized with 1–2% isoflurane, and placed in a stereotaxic apparatus (Kopf Instruments) on a heating pad (Harvard Apparatus). Fur was removed from the scalp, the incision site was cleaned with betadine and a midline incision was made. Sterile surgical techniques were used, and mice were injected with sustained-release buprenorphine for post-operative recovery. Mice were allowed to recover for at least two weeks after surgery before behavioural experiments.

36For intracranial optogenetic experiments, virus was injected using a 33-gauge beveled needle and a 10-µl Nano-fil syringe (World Precision Instruments), controlled by an injection pump (Harvard Apparatus). Five hundred nanolitres of AAVdj-hSyn::iC++-eYFP or AAVdj-hSyn::eYFP (5×1011 vg ml−1) was injected at 150 nl per min and the syringe was left in place for at least 10 min before removal. The following coordinates were used (relative to Bregma): posterior insula (−0.58 (anterior–posterior (AP)), ±4.2 (medial–lateral (ML)), −3.85 (dorsal–ventral (DV)); mPFC (1.8 (AP), ±0.35 (ML), −2.9 (DV)). Optical fibres (0.39 NA, 200 µm; Thorlabs) were implanted 200 µm above virus injection coordinates. Fibres were secured to the cranium using Metabond (Parkell). Mice were allowed to recover for at least two weeks before behavioural testing.

37The mice with or without cardiac-targeted ChRmine expression were implanted with custom-made headplates, reference electrodes and cyanoacrylate-adhesive-based ‘clear-skull caps’ as previously described. After recovery, mice were water-restricted and habituated to head fixation, but they were allowed to drink water to satiate thirst before recording sessions. Craniotomies were made with a dental drill at least several hours before recording sessions and were sealed with Kwik-Cast (World Precision Instruments). Exposed craniotomies before, during and after recordings were kept moist with frequent application of saline until sealed with Kwik-Cast.

38Before recordings, the mice were placed into the pacemaker vests and reliable pacing was confirmed by ECG under brief anaesthesia with isoflurane. Then the mice were head-fixed and allowed to recover. Next, one or two (for simultaneous bilateral recordings) four-shank Neuropixels 2.0 probes mounted on a multi-probe manipulator system (New Scale Technologies) and controlled by SpikeGLX software (Janelia Research Campus) were inserted through the craniotomies at variable angles (0–20°) depending on the recording geometry. Typically the probes were aimed to touch the skull around the insula, which could be inferred from probe bending or changes in local field potential, and then were retracted around 100 µm and allowed to sit in place for at least 15 min before recordings. Recordings were performed along each of the four shanks sequentially while mice received 5 s of optical stimulation (900 bpm (15 Hz)) with inter-trial intervals of at least 15–25 s. Probes were cleaned with trypsin between recording sessions. Spike sorting was performed by Kilosort 2.5 and auxiliary software as previously described.

39After recordings, the brains were perfused, cleared, imaged and registered to the Allen Brain Atlas as previously described. Using the traces of lipophilic dye CM-DiI or DiD (which coated the probes before each insertion) and electrophysiological features, the atlas coordinates of the recorded single units were determined.

40The spikes from single units were aligned to pacing onset, and the visualized peri-stimulus time histograms were calculated by subtracting 5 s baseline firing rate, 10 ms binning and 500 ms half-Gaussian filtering. The population-averaged firing rate of each region was calculated by combining z-scores (before filtering) over time for all single units in the region of interest. Specifically, we used hierarchical bootstrap to combine data from multiple levels as previously described. For each condition, 100 bootstrap datasets were generated, and their mean and s.d. represented the mean and s.e.m. of the initial dataset. For statistical tests comparing ChRmine and control groups, the one-sided P value for the null hypothesis (the ChRmine firing rate subtracted by the control firing rate is zero) was calculated as the fraction of these subtracted values from the pairs of the resampled means (averaged over the time window of interest) that were smaller than zero.

41For optogenetic inhibition of iC++, a 473-nm laser (Omicron Laserage) was used to deliver constant light at 2–3 mW measured from the tip. Laser shutters were controlled using a Master-8 receiving synchronized input from behaviour apparatus and control software (Ethovision).

42The target number of subjects used in each experiment was determined on the basis of numbers in previously published studies. No statistical methods were used to predetermine sample size or randomize. Criteria for excluding mice from analysis are listed in the methods. Mean ± s.e.m. was used to report statistics. The statistical test used, definition of n and multiple-hypothesis correction where appropriate are described in the figure legends. Unless otherwise stated, all statistical tests were two-sided. Significance was defined as alpha = 0.05. All statistical analyses were performed in GraphPad Prism 9.

43Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.

44Any methods, additional references, Nature Portfolio reporting summaries, source data, extended data, supplementary information, acknowledgements, peer review information; details of author contributions and competing interests; and statements of data and code availability are available at 10.1038/s41586-023-05748-8.