Cytotoxicity of crystals involves RIPK3-MLKL-mediated necroptosis

1Crystals are deposits of various sizes and shapes composed of atoms, ions or biomolecules, frequently with tissue injury, inflammation and remodelling. Two mechanisms may explain this association: (I) nucleation or crystal growth from a seed crystal formed on a surface medium, for example tubular epithelial cells, urolithiasis forming at Randall's plaques, calcifications in injured tendons, damaged cartilage or atheromatous vascular lesions, (II) crystal formation itself causes tissue injury and inflammation, for example in gouty arthritis, pulmonary silicosis or asbestosis, cholesterol crystals driving atherogenesis and in oxalate, cystine or urate nephropathy. Crystals trigger tissue inflammation via the NLRP3 inflammasome- and caspase-1-mediated secretion of IL-1β and IL-18 (refs,,,, ). However, crystals also exert direct cytotoxic effects leading to necrotic rather than apoptotic cell death. It is still unknown, whether crystal deposition causes necrosis in a passive-mechanical or in one of the recently identified modalities of regulated cell death. We hypothesized that crystal-induced tissue injury involves a regulated form of cell death and that the identification of this pathway may reveal new targets for therapeutic intervention that limit crystal-related tissue injury and organ dysfunction. Our results show that various crystals uniformly induce necroptosis, that is, a receptor-interacting serine-threonine kinase 3- (RIPK3) and mixed lineage kinase domain-like (MLKL)-dependent form of primary necrosis in vitro, in vivo and in human disease. These data identify several molecular targets for pharmacological intervention to limit tissue injury in crystallopathies.

2What is the mode of crystal-induced cell death? To address this question we first studied the cytoxic effects of calcium oxalate (CaOx), monosodium urate (MSU), calcium pyrophosphate dihydrate (CPPD) and cystine crystals on kidney epithelial cells in vitro. Transmission electron microscopy images and rhodamine-sytox stains to identify living and dead cells, respectively, showed that kidney tubular epithelial cells die by primary necrosis after crystal exposure (Fig. 1a). In addition, we employed flow cytometry to better characterize the mode of CaOx-induced cell death. To this end sideward scatter, forward scatter, Hoechst 33342, annexin V, 1,1′-dioctadecyl-3,3,3′,3′-tetramethyl-indocarbocyanine perchlorate, and prodidium iodide were measured. We found that CaOx crystals induced primary necrosis without signs of apoptosis (Fig. 1b,c), evidenced by pan-caspase inhibition not affecting cytotoxicity of any of the aforementioned crystals (Fig. 1d). Also the kinetics of crystal cytotoxicity were caspase independent (Supplementary Fig. 1A) and absence of NLRP3 did not affect CaOx crystal-induced cytotoxicity (Supplementary Fig. 1B). This, being a caspase-independent mode of cell death, excluded NLRP3-caspase-1/11-dependent pyroptosis. We conclude that crystal cytotoxicity does not involve apoptosis or pyroptosis but largely represents primary cellular necrosis.

3Having excluded the contribution of caspase-dependent forms of cell death, we focussed on necroptosis, a known regulated form of necrosis of non-immune cells. We found the key proteins of the necroptosis pathway, that is, tumour-necrosis factor receptor-1 (TNFR1), RIPK1, RIPK3 and MLKL to be induced in tubular epithelial cells on exposure to various crystals (Fig. 2a). The RIPK1 stabilizer necrostatin-1 (ref. ) partially (MSU, CPPD and cystine) or entirely (CaOx) prevented crystal-induced tubular epithelial cell death also in the absence of ZVAD–FMK (Fig. 2b and Supplementary Fig. 1C), suggesting a role for RIPK1 independent of caspases. When crystals were replaced by recombinant TNF-α as a stimulus, necrostatin-1 had the same effect. However, TNFR1 was not required for crystal-induced cell death in vitro (Supplementary Fig. 1B). Necrostatin-1 also suppressed crystal cytotoxicity in L929 cells, primary human synovial fibroblasts and HK-2 cells (Supplementary Fig. 2). The protective effect of necrostatin-1 on the cytotoxicity of crystals was confirmed by fluorescence imaging using the cell death marker prodidium iodide that enters cells only on the disruption of the plasma membrane (Fig. 2c). Both Ripk3 or Mlkl deficiency or knockdown of either RIPK3 or MLKL with specific siRNA partially abrogated, whereas knockdown of caspase-8 somewhat enhanced crystal-induced cytotoxicity in tubular epithelial cells (Fig. 3a–c and Supplementary Fig. 3). Furthermore, pre-treatment with the putative inhibitor of RIPK3 dabrafenib also protected tubular epithelial cells from crystal-induced cytotoxicity in a dose-dependent manner (Fig. 3d). Together, these data imply that crystal-induced primary necrosis may involve RIPK3/MLKL-dependent necroptosis.

4Crystal nephropathy (CN) is an example of crystal-induced tissue injury and organ failure. Mice exposure to oxalate induces oxalate nephropathy, a model that mimics CN in humans, including an increase of serum creatinine and blood urea nitrogen (BUN). Acute oxalate exposure leads to CaOx crystal deposition in the mouse kidney. At the structural level CaOx crystal plugs forms within the proximal and distal tubules (Fig. 4a–d). CaOx crystals are also found within the interstitium (Fig. 4c). Transmission electron microscopy detected luminal crystal plugs and smaller sized crystals within tubular epithelial cells (Fig. 4e–g). Injured epithelial cells often exhibited ultrastructural signs of necrosis, such as loss of electon density and balloning of the mitochondria, nuclear chromatin irregularities, outer membrane disruption, and cytoplasm and organelle expulsion (Fig. 4h). Quick-freeze deep-etch electron microscopy illustrates crystal deposition involving cytoplasmic organelles on rupture of plasma membranes (Fig. 4i). Thus, crystal formation within the kidney is associated with necrosis of tubular epithelial cells in a temporal and spatial manner. The phenotype is associated with the induction of renal expression of TNFR1, RIPK1, RIPK3 and MLKL messenger RNA (mRNA) (Fig. 5a). We validated the in vivo contribution of this pathway by inducing oxalate nephropathy in wild type and Ripk3- and Mlkl-deficient mice. Oxalate exposure induced identical CaOx crystal deposits in both mouse strains (Fig. 5b), but all functional and structural parameters of acute CN were significantly reduced in Ripk3- or Mlkl-deficient mice (Fig. 5c–h). These include serum creatinine levels, markers of tubule necrosis and neutrophil recruitment. These results show that the necroptosis-related proteins RIPK3 and MLKL mediate oxalate crystal-induced cell necrosis in vivo.

5We performed several in vitro and in vivo experiments to test the possibility that tubule protection in Ripk3- and Mlkl-deficient mice is a secondary effect possibly due to a role of RIPK1–RIPK3–MLKL signalling in neutrophil recruitment. Intraperitoneal (i.p.) injection of various types of crystals induced neutrophil recruitment into the peritoneal cavity as a marker of crystal-induced peritonitis, which was not affected by necrostatin-1 (Fig. 6a,b). Injection of crystals into air pouches at the back of mice with and without systemic necrostatin-1 treatment gave identical results (Fig. 6c and Supplementary Fig. 4). Importantly, we assured the plasma activity of the same charge of necrostatin-1 in vivo in a similar time frame by testing microvascular permeability and leucocyte extravasation during postischemic cremaster muscle injury (Fig. 6d–f). We conclude that the necrostatin-1-mediated effects on tissue injury do not involve a direct effect on neutrophil recruitment.

6Crystals did not require TNFR1 to induce tubular epithelial cell necroptosis in vitro, necrosis-driven renal inflammation (‘necroinflammation') may induce additional TNF-α-triggered necroptosis in vivo, for example, via surface TNFR1 on tubular epithelial cells. Renal mRNA and protein levels of TNF-α and TNFR1 were induced in CaOx nephropathy at 24 h (Supplementary Fig. 5A–C). A careful analysis of early time points of oxalate nephropathy revealed that kidney injury occurred several hours before intrarenal TNF expression (Supplementary Fig. 6). Flow cytometry revealed that TNF-α was not only expressed by intrarenal mononuclear phagocytes but also by non-immune cells (Supplementary Fig. 5D). Immunostaining localized TNF-α expression to tubules but also interstitial cells, while TNFR1 and -2 were mostly induced in tubular epithelial cells (Supplementary Fig. 5E). To test for a possible functional contribution of TNFR signalling we induced CN in Tnfr1-deficient and Tnfr1/2 double-deficient mice. Oxalate exposure resulted in identical CaOx crystal deposits in all mouse strains, however, all functional and structural parameters of acute CN were significantly reduced in Tnfr1-deficient mice (Fig. 7). These include serum creatinine levels, BUN, tubule necrosis and neutrophil recruitment. Concomitant deficiency in TNFR2 had no additive effects on this phenotype, suggesting that TNFR1 mainly accounts for this effect. Thus, although direct crystal-induced necroptosis does not require TNFR1, in vivo, crystal-induced necroinflammation involves additional TNFR1 signalling-related cell death, which contributes to CN.

7If TNFR1/RIPK1/RIPK3/MLKL-mediated necroptosis drives tubule necrosis in CN then inhibition of either TNF-α, TNFR signalling or RIPK1 might be valuable therapeutic targets. To test this hypothesis we treated mice with the TNF-α blocker etanercept, the TNFR internalization inhibitor R-7050, or with necrostatin-1. Oxalate exposure resulted in equal amounts of CaOx crystal deposits in all groups of mice but etanercept, R-7050 or necrostatin-1 significantly reduced all functional and structural aspects of CN, that is, serum creatinine levels, tubule necrosis, neutrophil influx and the mRNA expression of kidney injury markers (Fig. 8). Thus, crystal-induced TNF-α release and the subsequent TNFR1-triggered activation of RIPK1–RIPK3–MLKL-executed tubular cell necroptosis represent therapeutic targets in CN. Using etanercept, R-7050 or necrostatin-1 may have therapeutic potential.

8To test validate our mouse data in human disease we first analysed crystal cytotoxicity in human renal progenitor cells, that are considered to contribute to the turnover of tubular epithelial cells and their regeneration upon injury. For all the crystals tested the results were identical to the other cell types examined before (Fig. 9a–d and Supplementary Fig. 7). Of 64,000 renal biopsies, 1,119 cases (1.7%) with documented CaOx crystals were identified by light microscopy and birefringence under polarized light. In all, 412 of these 1,119 cases (37 or 0.6% of total) biopsy cases showed CaOx crystals in association with acute tubular injury, which represented 10% of all 4,125 biopsy cases with acute kidney injury as the leading clinical diagnosis. Immunostaining revealed diffuse tubular positivity for TNF-α, TNFR1 and total MLKL, while phosphorylated MLKL was detected only in single cells (Fig. 9e). We conclude that crystal-induced cytotoxicities of human and murine kidney cells are comparable and that human tubular epithelial cells also activate MLKL in the context of oxalate crystal-induced acute kidney injury.

9Various crystals trigger cell death and inflammation. While inflammation was traditionally thought to be secondary to tissue injury, the discovery of crystals being agonists of the NLRP3 inflammasome raises the question whether crystal cytotoxicity is a consequence of NLRP3 activation or an inflammasome-independent event with distinct signalling pathways. Crystals are NLRP3 agonists, which could imply triggering also NLRP3-caspase-1/11-mediated pyroptosis, a mode of regulated cell death occurring in infected macrophages. We excluded this option as Nlrp3-deficiency or caspase blockade did not affect crystal cytotoxicity. Caspase blockade virtually also excluded apoptosis as another form of regulated cell death, which was consistent with our flow cytometry results and the results of a previously published report. In contrast, we found that the cytotoxicity of crystals involves necroptosis, an injury-driven form of regulated cell death driven by the phosphorylation of the pseudokinase MLKL. Knockdown of RIPK3 and MLKL almost entirely abrogated crystal cytotoxicity in vitro, suggesting strongly that necroptosis is the predominant form of crystal-induced cell death. As further lines of evidence, lack of Ripk3 and Mlkl also almost entirely abrogated oxalate nephropathy in vivo. These data further support the concept that cell necrosis is the initial event of crystal-induced necroinflammation and that blocking necroptosis during the early stage of tissue injury is sufficient to prevent subsequent auto-amplification loop of inflammation, immune-mediated pathology and organ failure. However, RIPK3 is also involved in NLRP3 inflammasome activation, which is an important trigger of tissue inflammation in oxalate nephropathy. Of note NLRP3 and ASC deficiency both lacked oxalate-induced kidney injury, and was exclusively mediated by intrarenal dendritic cells, which excludes any inflammasome signalling in non-immune kidney cells. Therefore, the in vivo phenotype of the RIPK3 knockout may also involve impaired NLRP3/ASC signalling in intrarenal dendritic cells.

10Providing evidence that necroptosis is also involved in human disease is difficult because the different forms of regulated necrosis cannot be distinguished by ultrastructural morphological criteria. To resolve this issue we used immunostaining for phosphorylated MLKL, which suggests MLKL-dependent regulated necrosis also in human oxalate nephropathy.

11Necrostatin-1 keeps RIPK1 in an anti-necroptotic conformation and protected from crystal-induced cytotoxicity. As RIPK1 interacts with the intracellular domain of TNFR1 via its death domain and TNFR1-mediated necroptosis is considered a prototype of regulated necrosis, it is tempting to speculate that RIPK1 loses its protective function against crystal-induced organ failure presumably by post-translational events, such as deubiquitination on TNFR1 ligation. Consistently, lack of TNFR1 or treatment with etanercept abrogated CN in vivo, but not crystal-induced cytotoxicity in vitro. This should relate to the lack of direct interaction between crystals and TNFR1 and the absence of TNF-α in the in vitro system (Supplementary Fig. 8). In vivo, however, TNF-α is secreted by infiltrating immune cells, which triggers necroptosis in additional cell populations secondary to the initial direct activation by crystals, thus contributing to the auto-amplification loop of necroinflammation. The selective expression of TNF-α and TNFR1 in tubules of human oxalate nephropathy implies a similar role also in human disease.

12How exactly crystals trigger RIPK1 activation remains uncertain. MSU crystals can induce Syk signalling in dendritic cells via biding to lipid rafts. MSU crystals also affect signalling by binding to the surface receptor Clec12A but this interaction does not apply to other crystals. Crystals activate the NLRP3 inflammasome via lysosomal leakage of cathepsins into the cytosol. Cathepsin B was reported to inhibit necroptosis by cleaving RIPK1 (ref. ). This could also be an avenue of crystal-induced necroptosis.

13In conclusion, crystal cytotoxicity involves necroptosis as a form of regulated cell death in vitro and in vivo. In vivo, also secondary TNF-driven necroptosis adds in (Fig. 10). Consequently, the therapeutic blockade of this pathway, for example, with soluble TNFR2-IgG fusion protein or the RIPK1 stabilizer necrostatin-1, can prevent crystal-induced tissue necrosis and organ dysfunction. These findings imply TNFR1, RIPK1, RIPK3 and MLKL being potential therapeutic targets to limit tissue injury in crystallopathies.

14C57BL/6N mice were procured from Charles River Laboratories (Sulzfeld, Germany). Tnfr1−/− and Tnfr2−/− mice were originally obtained from the Jackson Laboratories (Bar Harbour, ME) and bred under specific pathogen-free conditions. Tnfr1/2 double-deficient mice (Tnfr1,2−/−) were generated by cross-breeding Tnfr1−/− and Tnfr2−/− mice. Ripk3−/− mice were kindly provided by V. Dixit, Genentech, USA and Mlkl−/− mice were kindly provided by J. Murphy, WEHI, Australia. Mice were housed in groups of five under specific pathogen-free conditions with unlimited access to food and water. Six- to eight-week-old male mice received a single intraperitoneal (i.p.) injection of 100 mg kg−1 of sodium oxalate (Santa Cruz Biotechnology, USA) and 3% sodium oxalate in drinking water and kidneys were harvested after 24 h. As a therapeutic strategy, mice received a single dose of either etanercept (10 mg kg−1 i.p., Pfizer, Germany) or necrostatin-1 (1.65 mg kg−1 i.p., Millipore, Germany) or R-7050 (18 mg kg−1 i.p., Santa Cruz Biotechnology, USA) before sodium oxalate injections. Blood, urine and kidneys were collected at sacrifice by cervical dislocation. Kidneys were kept at −80 °C for protein isolation and in RNA later solution at −20 °C for RNA isolation. One part of the kidney was also kept in formalin to be embedded in paraffin for histological analysis. Samples for electron microscopy were fixed in glutaraldehyde. Sample sizes were determined by G*Power (Germany). All kidney disease experimental procedures were approved by the Regierung von Oberbayern, München, Germany.

15For peritonitis studies, peritonitis was induced by injection of 1 mg of crystals in 0.5 ml sterile PBS. Mice received a single injection of either Nec-1 (1.65 mg kg−1) or vehicle half an hour before crystals injections. After 6 h, mice were killed and peritoneal cavities were washed with 5 ml of PBS. The lavage fluids were analysed for polymorphonuclear neutrophil recruitment by fluorescence-activated cell sorting using the neutrophil marker Ly-6G (BD Biosciences, Germany).

16For air pouch studies, murine air pouches were generated using standard protocols in groups of 6-weeks-old Balb/c mice (n=5). In brief, we injected 3 ml of sterile air subcutaneously into the back of anaesthetized mice to form an air pouch. An additional 2 ml of sterile air was injected into pre-existent pouch 3 days after the first injection. Another 2 days later, we injected 2.5 mg crystals in PBS, 2.5 mg crystals plus 1.65 mg kg−1 necrostatin-1 into the air pouches. Crystals of CaOx, MSU, CPPD and cystine were used in each independent experiment. After 24 h the pouch fluid was collected, and neutrophils in the air lavage were analysed by fluorescence-activated cell sorting. The studies were conducted according to guidelines determined by the Law of the Ministry of Healthcare of Ukraine, No. 281 from 1 November 2011 for the care and use of laboratory animals and were approved by the Ethics Council of the Danylo Halytsky Lviv National Medical University.

17For mouse cremaster muscle IR injury assay, cremaster muscle was prepared for experiment as originally described by Baez with minor modifications. Briefly, mice were anesthetized using intraperitoneal (i.p.) injection of ketamine/xylazine mixture. The left femoral artery was cannulated for administration of microspheres and drugs. The right cremaster muscle was exposed through a ventral incision of the scrotum. Epididymis and testicle were detached from the cremaster muscle and placed into the abdominal cavity. Throughout experimental procedure the muscle was superfused with warm-buffered saline. Olympus BX 50 upright microscope (Olympus Microscopy, Germany) equipped for stroboscopic fluorescence epi-illumination microscopy was used for in vivo microsopy. For measurement of centerline blood flow velocity, green fluorescent microspheres (0.96 μm diameter, Molecular Probes, Leiden, the Netherlands) were injected via the femoral artery catheter, and their passage through the vessels of interest was recorded using the fluorescein isothiocyanate (FITC) filter cube under appropriate stroboscopic illumination (exposure, 1 ms; cycle time, 10 ms; l=488 nm), integrating video images for sufficient time (>80 ms) to allow for the recording of several images of the same bead on one frame. Beads that were flowing freely along the centerline of the vessels were used to determine blood flow velocity. For offline analysis of parameters describing the sequential steps of leucocyte extravasation, we used the Cap-Image image analysis software (Dr Zeintl, Germany). Animals were treated with necrostatin-1 (1.65 mg kg−1 i.p.) or vehicle 30 min before the experiment. For the analysis of postischemic leucocyte responses, three postcapillary vessel segments in a central area of the spread out cremaster muscle were randomly chosen. Ischaemia was induced by clamping all supplying vessels at the base of the cremaster muscle using a vascular clamp (Martin, Germany). After 30 min of ischaemia, the vascular clamp was removed and reperfusion was restored for 160 min. Measurements were repeated at 60 and 120 min after onset of reperfusion. Subsequently, FITC dextran was infused intra-arterial for the analysis of microvascular permeability. Analysis of microvascular permeability was performed as follows. The macromolecule FITC dextran (5 mg in 0.1 ml saline, Mr 150,000 Da, Sigma Aldrich) was infused intra-arterial after determination of centerline blood flow velocity. Mean grey values of fluorescence intensity were measured by digital image analysis (TILLvisION 4.0, TILL Photonics) in six randomly selected regions of interest (50 × 50 μm2), localized 50 μm distant from the postcapillary venule under investigation. The average of mean grey values was calculated.

18Mice kidney sections of 2 μm were stained with periodic acid-Schiff reagent. Tubular injury was scored by assessing the percentage of necrotic tubules and presence of tubular casts. Ly6B.2+ neutrophils were identified by immunostaining (1:200; Serotec, UK, #MCA771GA). Pizzolato's staining visualized CaOx crystals and crystal deposit formation in the kidney was evaluated as in refs,: no deposits=0 point; crystals in papillary tip=1 point; crystals in cortical medullary junction=2 points; crystals in cortex=3 points. When crystals were observed in multiple areas, the points were combined. The expression of TNF-α (1:200, R&D, Germany, #AF410NA) and TNFR1 (1:800, Abcam, UK, #ab19139) was analysed by immunostaining. Plasma creatinine and BUN were measured using Urea FS kit (DiaSys Diagnostic Systems, Germany) according to the manufacturer's protocol. Neutrophil infiltrates were counted in 15 high power fields per section. A cell death detection (TUNEL) kit (Roche, Germany) was used to quantify dead cells. A retrospective screening for CaOx deposits in 64,000 medical and transplant kidney biopsies renal biopsies in the Nephropath data base was performed (IRB number: 05-4397-0). An informed consent was obtained from all subjects. Paraffin sections from human native kidney biopsies were stained with 1:100 rabbit anti p-MLKL (Abcam, USA) and anti-rabbit IgG Alexa Flur 555. All assessments were performed in a blind manner.

19For scanning electron microscopy, kidney tissue were rinsed with PBS and postfixed with 1% aqueous osmium tetroxide for a total of 2.5 h. Subsequently, tissues were rinsed and dehydrated through a graded series of ethanol to absolute ethanol and critical point dried using liquid CO2. After mounting on stubs the specimens were sputter coated with a gold-palladium alloy for 1.5 min. Images were viewed with a Hitachi 2600 electron microscope.

20For transmission electron microscopy, kidneys were immersed in cold modified Karnovsky's fixative containing 3% glutaraldehyde and 1% paraformaldehyde in sodium cacodylate buffer (pH 7.4) processed as follows. After overnight fixation, kidneys were postfixed in 2% osmium tetraoxide, dehydrated through graded concentrations of ethanol and embedded in EMBed-812. Ultrathin sections of kidney were cut onto formvar-coated slot grids, and subsequently stained with uranyl acetate and lead citrate. The samples were viewed with a JEOL model 1200EX electron microscope (JEOL, Tokyo, Japan).

21In another experiment, mouse tubular cells (MTCs) were grown on Thincerts (Greiner bio-one, Germany), and stimulated with crystals of CaOx (1,000 μg ml−1), MSU (500 μg ml−1), CPPD (500 μg ml−1) and cysteine (500 μg ml−1) for 24 h. Cells were then fixed for 1 h at room temperature by replacing the growth medium with 3% glutaraldehyde in PBS (pH 7.2). The Thincerts were then washed three times with PBS (pH 7.2) buffer and sliced into 3-mm squares. These pieces were postfixed in 2% aqueous osmium tetroxide for 2 h and then dehydrated through an ethanol series. After three washes in 100% ethanol, the pieces were transferred to acetone, then infiltrated and embedded in Epon. Sections ∼70 nm thick were cut using a diamond knife, collected on copper grids, and stained sequentially with uranyl acetate (saturated in 50% ethanol) and Reynolds' lead citrate. Sections were examined and photographed by a JEOL 1200 EXII transmission electron microscope at 80 kv.

22For quick-freeze deep-etch electron microscopy, 1.5 mm bread slices of non-fixed kidney or kidney sections fixed overnight in 2% glutaraldehyde in 100 mM NaCl, 30 mM Hepes, 2 mM CaCl2, pH 7.2 (NaHCa) were used after rinsing in NaHCa. Tissues were then cooled to 4 °K with liquid helium mounted in a Balzers 400 vacuum evaporator fractured and etched for 2.5 min at −104 °C and rotary replicated with∼3 nm platinum. The process involved fracturing the kidney sample with a cryomicrotome under high vacuum, then allowed to partially freeze dry (this is called deep-etching), then covered with a thin film of platinum that forms a replica of the fractured and etched tissue. Then the sample was allowed to thaw so that the replica could be collected and viewed with transmission microscope (JEOL 1400 with attached AMT digital camera).

23Total RNA was isolated from kidneys using a Qiagen RNA extraction kit (Qiagen, Germany) following the manufacturer's instructions. After quantification RNA quality was assessed using agarose gels. From isolated RNA, complementary DNA was prepared using reverse transcriptase (Superscript II; Invitrogen, USA). Real-time reverse transcription PCR was performed using SYBRGreen PCR master mix and was analysed with a Light Cycler 480 (Roche, Germany). All gene expression values were normalized using 18 s RNA as a house keeping gene. All primers used for amplification were from Metabion (Martinsried, Germany). The expression of KIM-1, π-GST, TNFR1, RIPK1, RIPK3 and MLKL was tested using primers as follows: Kim-1: 5′-TCAGCTCGGGAATGCACA-3′ (for), 5′-TGGTTGCCTTCCGTGTCT-3′ (rev); π-GST: 5′-CGCAGCACTGAATCCGCACC-3′ (for), 5′-ACACCGCCCTCGAACTGGGAA-3′ (rev); TNFR1:-5′-GCAACAGCACCGCAGTAGCTGA-3′ (for), 5′-GTGCGTCCCTTGCAGCCACT-3′ (rev); RIPK1: 5′-GACTGTGTACCCTTACCTCCGA-3′ (for), CACTGCGATCATTCTCGTCCTG5′- (rev); RIPK3: 5′-GAAGACACGGCACTCCTTGGTA-3′ (for), 5′-CTTGAGGCAGTAGTTCTTGGTGG-3′ (rev), MLKL: 5′-CTGAGGGAACTGCTGGATAGAG-3′ (for), 5′-CGAGGAAACTGGAGCTGCTGAT-3′ (rev), Caspase-8: 5′-ATGGCTACGGTGAAGAACTGCG-3′ (for), 5′-TAGTTCACGCCAGTCAGGATGC-3′ (rev).

24MTCs, human synovial fibroblasts (K4IM cells) and L929 cells were maintained in DMEM/F12 (GIBCO, Invitrogen, CA, USA) containing 10% fetal calf serum, 1% penicillin–streptomycin. Human kidney cells (HK-2) were maintained in RPMI (GIBCO, Invitrogen, CA, USA) containing 10% fetal calf serum and 1% penicillin–streptomycin. MTCs are a cell line immortalized with SV-40 virus, and K4IM cells are a cell line immortalized with SV-40 T large antigen. MTCs and K4IM cells were generously provided by EG Neilson and PJ Nelson, respectively. L929 and HK-2 cells were originally purchased from ATCC, and were generously provided by B Luckow and PJ Nelson, respectively. Human renal progenitor cells were prepared from human kidney tissues using standard sieving technique through graded mesh screens (60, 80, 150 and 200 mesh). All cells were stimulated with different doses of crystals of CaOx (1–2 μm size; Alfa aesar, Germany), MSU (25–125 nm size; Invivogen, Germany), CPPD (25–125 nm size; Invivogen, Germany) and cystine (1–2 μm size; Sigma Aldrich, Germany) in different experiments. Cells were pretreated with necrostatin-1 (50 or 100 μM) or ZVAD-FMK (10 μM) or combination or RIPK3 inhibitor dabrafenib (Selleckchem, Germany) 30 min before crystals stimulations whenever required. Primary tubular epithelial cells were isolated from the kidneys and were maintained in DMEM/F12 containing 10% fetal calf serum, 1% penicillin–streptomycin, 125 ng ml−1 prostaglandin E1 (Calbiochem, Germany), 25 ng ml−1 EGF, 1.8 μg ml−1 l-thyroxine, 3.38 ng ml−1 hydrocortisone and 2.5 mg ml−1 of insulin–transferrin—sodium selenite supplement (all from Sigma Aldrich, Germany unless mentioned). Cells were grown to confluence before use in experiments. Primary renal human progenitor cells were plated in EGM-MV (Lonza Ltd., Basel, Switzerland) with 20% FBS (Hyclone, Logan, Utah). Generation of clones was achieved by limiting dilution in 96-well plates and in four-chamber glass slides (VWR International, West Chester, Pennsylvania). All the cells were cultured in an incubator at 37 °C, 5%CO2. CellTiter 96 non-radioactive cell proliferation assay (MTT) kit (Promega, Germany) was used to evaluate cell survival after 24 h following the manufacturer's instructions. Results were expressed as percentage of the vehicle control.

25MTCs were transiently transfected with 25 nM of SiRNA duplexes specific for RIPK3 (s80755), MLKL (s92952), Caspase-8 (s63394), and scrambled siRNA (negative control no.1) (Ambion, USA) using Lipofectamine RNAiMAX transfection reagent (Life Technologies, Germany). 24 h after transfection cells were challenged to CaOx (1,000 μg ml−1), MSU (500 μg ml−1), CPPD (500 μg ml−1) and cystine (500 μg ml−1) for 24 h. Cell death was measured by prodidium iodide positivity and cell viability was analysed using 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay. Following small RNA sequences were used. Ripk3: 5′-CGGCUCUCGUCUUCAACAAtt-3′ (sense), 5′-UUGUUGAAGACGAGAGCCGgt-3′ (antisense); Mlkl: 5′-GAACCUGCCCGAUGACAUUtt-3′ (sense), 5′-AAUGUCAUCGGGCAGGUUCtt-3′ (antisense); Casp8: 5′-CAAGAACUAUAUUCCGGAUtt3′ (sense), 5′-AUCCGGAAUAUAGUUCUUGtg-3′ (antisense).

26Protein from kidney tissues and cells were extracted using lysis buffer (Tris-HCl 50 mM, NaCl 150 mM, sodium orthovanadate 100 μM, sodium deoxycholate 0.5%, NP40 4%, Triton X-100 2%, EDTA 5 mM, sucrose 300 mM, and Roche protease inhibitors). Total cellular extracts were prepared in protein lysis buffer (Tris 10 mM, NaCl 10 mM, ethylenediaminetetraacetic acid 10 mM, HEPES 1 mol l−1, glycerol 20%, MgCl2 1 mol l−1, dithiothreitol 1 mol l−1, Triton 10% sodium fluoride 1 mol l−1 and Roche protease inhibitors). After determination of protein concentrations, 50 μg of the kidney protein or 10 μg of protein extracted from cells was mixed with 5 × sodium dodecyl sulfate loading buffer (100 mmol l−1 Tris-HCl, 4% sodium dodecyl sulfate, 20% glycerol and 0.2% bromophenol blue) for western blot analysis. Samples were heated at 95 °C for 5 min. Proteins were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and then transferred to a polyvinylidene difluoride membrane. Nonspecific binding to the membrane was blocked for 1 h at room temperature with 5% bovine serum albumin in tris-buffered saline buffer (20 mmol l−1 Tris-HCl, 150 mmol l−1 NaCl and 0.1% Tween 20). The membranes were then incubated overnight at 4 °C with the following primary antibodies: TNFR1 (1:500, Abcam, UK, #ab19139), RIPK1 (1:200, BD, Germany, #610459), RIPK3 (1:200, Abcam, UK, #ab152130), anti-human phospho-MLKL (1:200, Millipore, Germany, #ABC234), anti-human total MLKL (1:200, Millipore, Germany, #17-10400), total MLKL (1:500, Abcam, UK, #ab194699) and β-actin (1:1000, Cell Signalling, USA, #4967), followed by incubation with secondary antibody anti-biotin or anti-rabbit IgG labelled with HRP. Immunostained bands were detected using a chemiluminescence kit (ECL kit, GE Healthcare, UK). Immunoblot images in Figs 2 and 9 as well as Supplementary Figs 3 and 5 have been cropped for presentation. Full size images are presented in Supplementary Figs 9 and 10.

27Cell death was induced in MTCs by irradiation with ultraviolet light type B at 1.5 mJ cm−2 s−1 or by treatment with CaOx crystals. Cell death was characterized by analysing six cytofluorometric parameters (size, granularity, penicillin–streptomycin exposure, plasma membrane integrity, mitochondrial membrane potential and DNA content) in a single tube measurement. This method detects eight phenotypically different subpopulations during the development of cell death in vitro. Briefly, collected cells were incubated for 30 min at room temperature with 400 μl of freshly prepared four-colour staining solution (1.8 μg ml−1 AxA5-FITC, 100 ng ml−1 prodidium iodide and 10 nM DiIC1(5), 1 ng ml−1 Hoechst 33342) in Ringer's solution and subsequently analysed. Flow cytometry was performed with a Gallios cytofluorometer (Beckman Coulter, Fullerton, USA). Excitation of FITC and prodidium iodide was at 488 nm, the FITC fluorescence was detected with the FL1 sensor (525/38 nm band pass (BP) filter), the prodidium iodide fluorescence with the FL3 sensor (620/30 nm BP), the DiIC1(5) fluorescence was excited at 638 nm and detected with the FL6 sensor (675/20 nm BP), and the Hoechst 33342 fluorescence was excited at 405 nm and detected with the FL9 sensor (430/40 nm BP). Electronic compensation was applied to reduce bleed through fluorescence. Data analysis was performed with Kaluza software version 2.0 (Beckman Coulter, Fullerton, USA). Cells were classified according to their location in the forward scatter (FSc; size) versus side scatter (SSc; granularity) dot plot and their staining patterns in the FL1 versus FL3 and FL6 versus FL9 dot plots as described elsewhere. In brief, cells were considered viable, if they (V1) do not expose phosphatidylserine on their surfaces (V2) display high mitochondrial membrane potential and (V3), if they exclude propidium iodide. Apoptotic cells are defined by (A1) exposure on their surfaces of phosphatidylserine (A2) and exclusion of propidium iodide. Cells are considered necrotic, if they display (N) permeability for the propidium cation of their plasma membranes. Cells are considered necrotic, if they allow the penetration of propidium iodide. Primary necrotic cells (no signs of apoptosis) do not display nuclear hypochromicity for propidium iodide (nuclear DNA is preserved). If the nuclei show nuclear hypochromicity (apoptosis has already started) the cells were considered secondary necrotic (loss of membrane selectivity of a cell executing apoptosis).

28Data are presented as mean±s.e.m. A comparison of groups was performed using paired Students t-test or one-way analysis of variance with post hoc Bonferroni's correction was used for multiple comparisons. A value of P<0.05 was considered to indicate statistical significance.

29How to cite this article: Mulay, S. R. et al. Cytotoxicity of crystals involves RIPK3-MLKL-mediated necroptosis. Nat. Commun. 7:10274 doi: 10.1038/ncomms10274 (2016).